read.abif: Read ABIF Files
In sangerseqR: Tools for Sanger Sequencing Data in R
Description
Usage
Arguments
Value
References
See Also
Examples
Description
Reads ABIF sanger sequencing data files. ABIF files are a proprietary binary
sanger sequencing chromatogram data file created by Applied Biosystems (see
http://home.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf). The file is read and parsed into an
abif class object. This method is based on the read.abif
function in the seqinr package available on CRAN.
Usage
1
read.abif(filename)
Arguments
filename
Location of the file.
Value
abif s4 object
References
Charif, D. and Lobry, J.R. (2007) SeqinR 1.0-2: a contributed
package to teh R project for statistical computing devoted to biological
sequences retrieval and analysis. Structural approches to sequenc eevolution:
Molecules, networks, populations. pp. 207-232.
See Also
Examples
1
2
3
4
hetab1 <- read.abif(system.file("extdata",
"heterozygous.ab1",
package = "sangerseqR"))
str(hetab1)
Example output
Loading required package: Biostrings
Loading required package: BiocGenerics
Loading required package: parallel
Attaching package: 'BiocGenerics'
The following objects are masked from 'package:parallel':
clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
clusterExport, clusterMap, parApply, parCapply, parLapply,
parLapplyLB, parRapply, parSapply, parSapplyLB
The following objects are masked from 'package:stats':
IQR, mad, sd, var, xtabs
The following objects are masked from 'package:base':
Filter, Find, Map, Position, Reduce, anyDuplicated, append,
as.data.frame, cbind, colMeans, colSums, colnames, do.call,
duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int,
pmin, pmin.int, rank, rbind, rowMeans, rowSums, rownames, sapply,
setdiff, sort, table, tapply, union, unique, unsplit, which,
which.max, which.min
Loading required package: S4Vectors
Loading required package: stats4
Attaching package: 'S4Vectors'
The following object is masked from 'package:base':
expand.grid
Loading required package: IRanges
Loading required package: XVector
Attaching package: 'Biostrings'
The following object is masked from 'package:base':
strsplit
Formal class 'abif' [package "sangerseqR"] with 3 slots
..@ header :Formal class 'abifHeader' [package "sangerseqR"] with 9 slots
.. .. ..@ abif : chr "ABIF"
.. .. ..@ version : int 101
.. .. ..@ name : raw [1:4] 74 64 69 72
.. .. ..@ number : int 1
.. .. ..@ elementtype: int 1023
.. .. ..@ elementsize: int 28
.. .. ..@ numelements: int 130
.. .. ..@ dataoffset : int 323971
.. .. ..@ datahandle : int 0
..@ directory:Formal class 'abifDirectory' [package "sangerseqR"] with 7 slots
.. .. ..@ name : chr [1:130] "AEPt" "AEPt" "APFN" "APXV" ...
.. .. ..@ tagnumber : int [1:130] 1 2 2 1 1 1 1 1 1 1 ...
.. .. ..@ elementtype: int [1:130] 4 4 18 19 19 19 2 5 4 4 ...
.. .. ..@ elementsize: int [1:130] 2 2 1 1 1 1 1 4 2 2 ...
.. .. ..@ numelements: int [1:130] 1 1 6 2 6 2 4503 1 1 1 ...
.. .. ..@ datasize : int [1:130] 2 2 6 2 6 2 4503 4 2 2 ...
.. .. ..@ dataoffset : int [1:130] 1113325568 1113325568 173231 838860800 163360 956301312 163366 0 65536 145752064 ...
..@ data :List of 130
.. ..$ AEPt.1 : int 16988
.. ..$ AEPt.2 : int 16988
.. ..$ APFN.2 : chr "Seq_A"
.. ..$ APXV.1 : chr "2"
.. ..$ APrN.1 : chr "Seq_A"
.. ..$ APrV.1 : chr "9"
.. ..$ APrX.1 : chr "<?xml version=\"1.0\" encoding=\"UTF-8\" standalone=\"yes\"?><AnalysisProtocolContainer doAnalysis=\"true\" nam"| __truncated__
.. ..$ ARTN.1 : int 0
.. ..$ ASPF.1 : int 1
.. ..$ ASPt.1 : int 2224
.. ..$ ASPt.2 : int 2224
.. ..$ AUDT.1 : int [1:1370] 64 126 65 54 55 79 81 183 49 123 ...
.. ..$ B1Pt.1 : int 2223
.. ..$ B1Pt.2 : int 2223
.. ..$ BCTS.1 : chr "2013-06-13 17:26:28 -06:00"
.. ..$ BufT.1 : int [1:1596] -27 -27 -27 -27 -27 -27 -27 -27 -27 -27 ...
.. ..$ CMNT.1 : chr "<ID:119209><WELL:G02>"
.. ..$ CTID.1 : chr "bdt1735"
.. ..$ CTNM.1 : chr "bdt1735"
.. ..$ CTOw.1 : chr "aadamson"
.. ..$ CTTL.1 : chr "Comment:"
.. ..$ CpEP.1 : chr ""
.. ..$ DATA.1 : int [1:18760] 5 4 4 13 -4 -3 4 5 10 -11 ...
.. ..$ DATA.2 : int [1:18760] -6 -2 -13 -7 10 8 -7 -2 -13 0 ...
.. ..$ DATA.3 : int [1:18760] 13 -4 8 -3 -16 -30 -13 4 -10 -14 ...
.. ..$ DATA.4 : int [1:18760] 9 10 2 0 11 27 16 -1 11 20 ...
.. ..$ DATA.5 : int [1:1596] 0 0 0 0 0 0 0 0 0 0 ...
.. ..$ DATA.6 : int [1:1596] 0 0 0 0 0 0 0 0 0 0 ...
.. ..$ DATA.7 : int [1:1596] 0 25 25 25 25 25 25 25 25 25 ...
.. ..$ DATA.8 : int [1:1596] 23 23 23 23 24 24 24 24 25 25 ...
.. ..$ DATA.9 : int [1:16215] 281 284 290 301 321 351 386 423 459 496 ...
.. ..$ DATA.10: int [1:16215] 0 0 0 1 2 4 4 2 1 0 ...
.. ..$ DATA.11: int [1:16215] 0 0 0 0 0 0 0 0 0 0 ...
.. ..$ DATA.12: int [1:16215] 25 29 35 47 67 92 117 137 152 165 ...
.. ..$ DCHT.1 : int 0
.. ..$ DSam.1 : int 1
.. ..$ DySN.1 : chr "Z-BigDyeV3"
.. ..$ Dye#.1 : int 4
.. ..$ DyeN.1 : chr "Dye1"
.. ..$ DyeN.2 : chr "Dye2"
.. ..$ DyeN.3 : chr "Dye3"
.. ..$ DyeN.4 : chr "Dye4"
.. ..$ DyeW.1 : int 540
.. ..$ DyeW.2 : int 568
.. ..$ DyeW.3 : int 595
.. ..$ DyeW.4 : int 615
.. ..$ EPVt.1 : int 8500
.. ..$ EVNT.1 : chr "Run Started"
.. ..$ EVNT.2 : chr "Run Stopped"
.. ..$ EVNT.3 : chr "Collection Started"
.. ..$ EVNT.4 : chr "Collection Stopped"
.. ..$ FTab.1 : raw [1:20] 00 01 00 01 ...
.. ..$ FVoc.1 : raw [1:18] 00 00 0b 2a ...
.. ..$ FWO_.1 : chr "GATC"
.. ..$ Feat.1 : raw [1:48] dc 01 03 00 ...
.. ..$ GTyp.1 : chr "POP7 "
.. ..$ HCFG.1 : chr "CE"
.. ..$ HCFG.2 : chr "37XX"
.. ..$ HCFG.3 : chr "3730xl"
.. ..$ HCFG.4 : chr "UnitID=3;CPUBoard=ECPU550;ArraySize=96;SerialNumber=1522-008;"
.. ..$ InSc.1 : int 15
.. ..$ InVt.1 : int 1500
.. ..$ LANE.1 : int 4
.. ..$ LAST.1 : chr "BCPFileName=KB.bcp;MobilityFileName=KB_3730_POP7_BDTv3.mob;StartPoint=0;BaseOneLocation=0;StopPoint=0;StopAtPCR"| __truncated__
.. ..$ LIMS.1 : chr "c22b71bfd45811e2bc82001aa0ae3c21"
.. ..$ LNTD.1 : int 50
.. ..$ LsrP.1 : int 25000
.. ..$ MCHN.1 : chr "3730-01-1522-008"
.. ..$ MODF.1 : chr "LongSeq50_POP7_1"
.. ..$ MODL.1 : chr "3730"
.. ..$ NAVG.1 : int 1
.. ..$ NLNE.1 : int 96
.. ..$ NOIS.1 : num [1:4] -6.45e+08 1.84e+31 6.92e+03 -3.26e-08
.. ..$ P1AM.1 : int [1:605] 380 694 836 934 1367 1063 2072 1502 1234 539 ...
.. ..$ P1RL.1 : int [1:605] 55 57 46 63 82 13 92 75 21 71 ...
.. ..$ P1WD.1 : int [1:605] 1264 1286 1600 6000 1755 1738 1395 1648 4600 3036 ...
.. ..$ P2AM.1 : int [1:605] 148 441 785 1272 687 1833 1357 2236 1917 1040 ...
.. ..$ P2BA.1 : chr "CCCCGTATTAGGGTGAAAAACCACGCGTAGTCCCGGGATAGTATAATACACCCACCAACCGGCAGAATTACGCATACGCCACTTAAATAGCACACACCGCGCTAAGCGACG"| __truncated__
.. ..$ P2RL.1 : int [1:605] 400 400 400 400 -33 400 500 -14 -300 -522 ...
.. ..$ PBAS.1 : chr "GGGGCATAAGARTGTTTTTTAAGGCGCATTCTTTTTTTAGAATATTATACATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGC"| __truncated__
.. ..$ PBAS.2 : chr "GGGGCATAAGARTGTTTTTTAAGGCGCATTCTTTTTTTAGAATATTATACATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGC"| __truncated__
.. ..$ PCON.1 : int [1:605] 12 13 9 5 5 3 5 7 3 3 ...
.. ..$ PCON.2 : int [1:605] 12 13 9 5 5 3 5 7 3 3 ...
.. ..$ PDMF.1 : chr "KB_3730_POP7_BDTv3.mob"
.. ..$ PDMF.2 : chr "KB_3730_POP7_BDTv3.mob"
.. ..$ PLOC.1 : int [1:605] 3 12 20 30 42 57 63 72 82 97 ...
.. ..$ PLOC.2 : int [1:605] 3 12 20 30 42 57 63 72 82 97 ...
.. ..$ PSZE.1 : int 384
.. ..$ PTYP.1 : chr "384-Well"
.. ..$ PXLB.1 : int 3
.. ..$ RGNm.1 : chr "HCI"
.. ..$ RGOw.1 : chr "Lab"
.. ..$ RMXV.1 : chr "1"
.. ..$ RMdN.1 : chr "LongSeq50_POP7_1"
.. ..$ RMdV.1 : chr "1"
.. ..$ RMdX.1 : chr "<?xml version=\"1.0\"?><Run-Module-Instance><Name>LongSeq50_POP7_1</Name><Version>1</Version><Method-Name>LongS"| __truncated__
.. ..$ RPrN.1 : chr "LongSeq50"
.. ..$ RPrV.1 : chr "1"
.. ..$ RUND.1 :List of 3
.. .. ..$ year : int 2013
.. .. ..$ month: int 6
.. .. ..$ day : int 13
.. .. [list output truncated]
sangerseqR documentation built on Nov. 8, 2020, 6:52 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Description Usage Arguments Value References See Also Examples
Description
Reads ABIF sanger sequencing data files. ABIF files are a proprietary binary
sanger sequencing chromatogram data file created by Applied Biosystems (see
http://home.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf). The file is read and parsed into an
abif class object. This method is based on the read.abif
function in the seqinr package available on CRAN.
Usage
1 | read.abif(filename)
|
Arguments
filename |
Location of the file. |
Value
abif s4 object
References
Charif, D. and Lobry, J.R. (2007) SeqinR 1.0-2: a contributed package to teh R project for statistical computing devoted to biological sequences retrieval and analysis. Structural approches to sequenc eevolution: Molecules, networks, populations. pp. 207-232.
See Also
Examples
1 2 3 4 | hetab1 <- read.abif(system.file("extdata",
"heterozygous.ab1",
package = "sangerseqR"))
str(hetab1)
|
Example output
Loading required package: Biostrings
Loading required package: BiocGenerics
Loading required package: parallel
Attaching package: 'BiocGenerics'
The following objects are masked from 'package:parallel':
clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
clusterExport, clusterMap, parApply, parCapply, parLapply,
parLapplyLB, parRapply, parSapply, parSapplyLB
The following objects are masked from 'package:stats':
IQR, mad, sd, var, xtabs
The following objects are masked from 'package:base':
Filter, Find, Map, Position, Reduce, anyDuplicated, append,
as.data.frame, cbind, colMeans, colSums, colnames, do.call,
duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int,
pmin, pmin.int, rank, rbind, rowMeans, rowSums, rownames, sapply,
setdiff, sort, table, tapply, union, unique, unsplit, which,
which.max, which.min
Loading required package: S4Vectors
Loading required package: stats4
Attaching package: 'S4Vectors'
The following object is masked from 'package:base':
expand.grid
Loading required package: IRanges
Loading required package: XVector
Attaching package: 'Biostrings'
The following object is masked from 'package:base':
strsplit
Formal class 'abif' [package "sangerseqR"] with 3 slots
..@ header :Formal class 'abifHeader' [package "sangerseqR"] with 9 slots
.. .. ..@ abif : chr "ABIF"
.. .. ..@ version : int 101
.. .. ..@ name : raw [1:4] 74 64 69 72
.. .. ..@ number : int 1
.. .. ..@ elementtype: int 1023
.. .. ..@ elementsize: int 28
.. .. ..@ numelements: int 130
.. .. ..@ dataoffset : int 323971
.. .. ..@ datahandle : int 0
..@ directory:Formal class 'abifDirectory' [package "sangerseqR"] with 7 slots
.. .. ..@ name : chr [1:130] "AEPt" "AEPt" "APFN" "APXV" ...
.. .. ..@ tagnumber : int [1:130] 1 2 2 1 1 1 1 1 1 1 ...
.. .. ..@ elementtype: int [1:130] 4 4 18 19 19 19 2 5 4 4 ...
.. .. ..@ elementsize: int [1:130] 2 2 1 1 1 1 1 4 2 2 ...
.. .. ..@ numelements: int [1:130] 1 1 6 2 6 2 4503 1 1 1 ...
.. .. ..@ datasize : int [1:130] 2 2 6 2 6 2 4503 4 2 2 ...
.. .. ..@ dataoffset : int [1:130] 1113325568 1113325568 173231 838860800 163360 956301312 163366 0 65536 145752064 ...
..@ data :List of 130
.. ..$ AEPt.1 : int 16988
.. ..$ AEPt.2 : int 16988
.. ..$ APFN.2 : chr "Seq_A"
.. ..$ APXV.1 : chr "2"
.. ..$ APrN.1 : chr "Seq_A"
.. ..$ APrV.1 : chr "9"
.. ..$ APrX.1 : chr "<?xml version=\"1.0\" encoding=\"UTF-8\" standalone=\"yes\"?><AnalysisProtocolContainer doAnalysis=\"true\" nam"| __truncated__
.. ..$ ARTN.1 : int 0
.. ..$ ASPF.1 : int 1
.. ..$ ASPt.1 : int 2224
.. ..$ ASPt.2 : int 2224
.. ..$ AUDT.1 : int [1:1370] 64 126 65 54 55 79 81 183 49 123 ...
.. ..$ B1Pt.1 : int 2223
.. ..$ B1Pt.2 : int 2223
.. ..$ BCTS.1 : chr "2013-06-13 17:26:28 -06:00"
.. ..$ BufT.1 : int [1:1596] -27 -27 -27 -27 -27 -27 -27 -27 -27 -27 ...
.. ..$ CMNT.1 : chr "<ID:119209><WELL:G02>"
.. ..$ CTID.1 : chr "bdt1735"
.. ..$ CTNM.1 : chr "bdt1735"
.. ..$ CTOw.1 : chr "aadamson"
.. ..$ CTTL.1 : chr "Comment:"
.. ..$ CpEP.1 : chr ""
.. ..$ DATA.1 : int [1:18760] 5 4 4 13 -4 -3 4 5 10 -11 ...
.. ..$ DATA.2 : int [1:18760] -6 -2 -13 -7 10 8 -7 -2 -13 0 ...
.. ..$ DATA.3 : int [1:18760] 13 -4 8 -3 -16 -30 -13 4 -10 -14 ...
.. ..$ DATA.4 : int [1:18760] 9 10 2 0 11 27 16 -1 11 20 ...
.. ..$ DATA.5 : int [1:1596] 0 0 0 0 0 0 0 0 0 0 ...
.. ..$ DATA.6 : int [1:1596] 0 0 0 0 0 0 0 0 0 0 ...
.. ..$ DATA.7 : int [1:1596] 0 25 25 25 25 25 25 25 25 25 ...
.. ..$ DATA.8 : int [1:1596] 23 23 23 23 24 24 24 24 25 25 ...
.. ..$ DATA.9 : int [1:16215] 281 284 290 301 321 351 386 423 459 496 ...
.. ..$ DATA.10: int [1:16215] 0 0 0 1 2 4 4 2 1 0 ...
.. ..$ DATA.11: int [1:16215] 0 0 0 0 0 0 0 0 0 0 ...
.. ..$ DATA.12: int [1:16215] 25 29 35 47 67 92 117 137 152 165 ...
.. ..$ DCHT.1 : int 0
.. ..$ DSam.1 : int 1
.. ..$ DySN.1 : chr "Z-BigDyeV3"
.. ..$ Dye#.1 : int 4
.. ..$ DyeN.1 : chr "Dye1"
.. ..$ DyeN.2 : chr "Dye2"
.. ..$ DyeN.3 : chr "Dye3"
.. ..$ DyeN.4 : chr "Dye4"
.. ..$ DyeW.1 : int 540
.. ..$ DyeW.2 : int 568
.. ..$ DyeW.3 : int 595
.. ..$ DyeW.4 : int 615
.. ..$ EPVt.1 : int 8500
.. ..$ EVNT.1 : chr "Run Started"
.. ..$ EVNT.2 : chr "Run Stopped"
.. ..$ EVNT.3 : chr "Collection Started"
.. ..$ EVNT.4 : chr "Collection Stopped"
.. ..$ FTab.1 : raw [1:20] 00 01 00 01 ...
.. ..$ FVoc.1 : raw [1:18] 00 00 0b 2a ...
.. ..$ FWO_.1 : chr "GATC"
.. ..$ Feat.1 : raw [1:48] dc 01 03 00 ...
.. ..$ GTyp.1 : chr "POP7 "
.. ..$ HCFG.1 : chr "CE"
.. ..$ HCFG.2 : chr "37XX"
.. ..$ HCFG.3 : chr "3730xl"
.. ..$ HCFG.4 : chr "UnitID=3;CPUBoard=ECPU550;ArraySize=96;SerialNumber=1522-008;"
.. ..$ InSc.1 : int 15
.. ..$ InVt.1 : int 1500
.. ..$ LANE.1 : int 4
.. ..$ LAST.1 : chr "BCPFileName=KB.bcp;MobilityFileName=KB_3730_POP7_BDTv3.mob;StartPoint=0;BaseOneLocation=0;StopPoint=0;StopAtPCR"| __truncated__
.. ..$ LIMS.1 : chr "c22b71bfd45811e2bc82001aa0ae3c21"
.. ..$ LNTD.1 : int 50
.. ..$ LsrP.1 : int 25000
.. ..$ MCHN.1 : chr "3730-01-1522-008"
.. ..$ MODF.1 : chr "LongSeq50_POP7_1"
.. ..$ MODL.1 : chr "3730"
.. ..$ NAVG.1 : int 1
.. ..$ NLNE.1 : int 96
.. ..$ NOIS.1 : num [1:4] -6.45e+08 1.84e+31 6.92e+03 -3.26e-08
.. ..$ P1AM.1 : int [1:605] 380 694 836 934 1367 1063 2072 1502 1234 539 ...
.. ..$ P1RL.1 : int [1:605] 55 57 46 63 82 13 92 75 21 71 ...
.. ..$ P1WD.1 : int [1:605] 1264 1286 1600 6000 1755 1738 1395 1648 4600 3036 ...
.. ..$ P2AM.1 : int [1:605] 148 441 785 1272 687 1833 1357 2236 1917 1040 ...
.. ..$ P2BA.1 : chr "CCCCGTATTAGGGTGAAAAACCACGCGTAGTCCCGGGATAGTATAATACACCCACCAACCGGCAGAATTACGCATACGCCACTTAAATAGCACACACCGCGCTAAGCGACG"| __truncated__
.. ..$ P2RL.1 : int [1:605] 400 400 400 400 -33 400 500 -14 -300 -522 ...
.. ..$ PBAS.1 : chr "GGGGCATAAGARTGTTTTTTAAGGCGCATTCTTTTTTTAGAATATTATACATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGC"| __truncated__
.. ..$ PBAS.2 : chr "GGGGCATAAGARTGTTTTTTAAGGCGCATTCTTTTTTTAGAATATTATACATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGC"| __truncated__
.. ..$ PCON.1 : int [1:605] 12 13 9 5 5 3 5 7 3 3 ...
.. ..$ PCON.2 : int [1:605] 12 13 9 5 5 3 5 7 3 3 ...
.. ..$ PDMF.1 : chr "KB_3730_POP7_BDTv3.mob"
.. ..$ PDMF.2 : chr "KB_3730_POP7_BDTv3.mob"
.. ..$ PLOC.1 : int [1:605] 3 12 20 30 42 57 63 72 82 97 ...
.. ..$ PLOC.2 : int [1:605] 3 12 20 30 42 57 63 72 82 97 ...
.. ..$ PSZE.1 : int 384
.. ..$ PTYP.1 : chr "384-Well"
.. ..$ PXLB.1 : int 3
.. ..$ RGNm.1 : chr "HCI"
.. ..$ RGOw.1 : chr "Lab"
.. ..$ RMXV.1 : chr "1"
.. ..$ RMdN.1 : chr "LongSeq50_POP7_1"
.. ..$ RMdV.1 : chr "1"
.. ..$ RMdX.1 : chr "<?xml version=\"1.0\"?><Run-Module-Instance><Name>LongSeq50_POP7_1</Name><Version>1</Version><Method-Name>LongS"| __truncated__
.. ..$ RPrN.1 : chr "LongSeq50"
.. ..$ RPrV.1 : chr "1"
.. ..$ RUND.1 :List of 3
.. .. ..$ year : int 2013
.. .. ..$ month: int 6
.. .. ..$ day : int 13
.. .. [list output truncated]
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.