F1_miRNA_count | R Documentation |
Count table of miRNAs in F1 species. The "F1" represents the polyploid progeny.
head(F1_miRNA_count) # sequence BF1.1 BF1.2 BF1.3 #1 TTTGGATTGAAGGGAGCTCTA 20233 6388 16732 #2 TTTCCAAATGTAGACAAAGCA 19909 5157 16076 #3 TCCCAAATGTAGACAAAGC 82 33 103 #4 CTTTGTCTATCGTTTGGAAAAG 2367 1040 3203 #5 TTGGACTGAAGGGAGCTCCTT 34 9 21 #6 TCGGACCAGGCTTCATTCCCC 3281 607 1289
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.