P1_miRNA_count | R Documentation |
Count table of miRNAs in P1 species. The "P1" represents one of parents.
head(P1_miRNA_count) # sequence Bnapus.1 Bnapus.2 Bnapus.3 #1 TTTGGATTGAAGGGAGCTCTA 29848 12094 10685 #2 TTAGATTCACGCACAAACTCG 986 571 456 #3 TGAAGCTGCCAGCATGATCTA 3152 1436 1091 #4 CTTTGTCTATCGTTTGGAAAAG 2449 1307 1116 #5 GATCATGTTCGCAGTTTCACC 1364 650 656 #6 TTTCCAAATGTAGACAAAGCA 11658 3914 4123
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.