P1_miRNA_count: Count table of miRNAs in P1 (P1: one of the parents).

P1_miRNA_countR Documentation

Count table of miRNAs in P1 (P1: one of the parents).

Description

Count table of miRNAs in P1 species. The "P1" represents one of parents.

Examples

head(P1_miRNA_count)
#                sequence   Bnapus.1   Bnapus.2   Bnapus.3
#1  TTTGGATTGAAGGGAGCTCTA      29848      12094      10685
#2  TTAGATTCACGCACAAACTCG        986        571        456
#3  TGAAGCTGCCAGCATGATCTA       3152       1436       1091
#4 CTTTGTCTATCGTTTGGAAAAG       2449       1307       1116
#5  GATCATGTTCGCAGTTTCACC       1364        650        656
#6  TTTCCAAATGTAGACAAAGCA      11658       3914       4123

ExpGenetic documentation built on Sept. 9, 2022, 9:06 a.m.