P1_miRNA_rpm: RPM table of miRNAs in P1 (P1: one of the parents).

P1_miRNA_rpmR Documentation

RPM table of miRNAs in P1 (P1: one of the parents).

Description

RPM table of miRNAs in P1 species. The "P1" represents one of parents.

Examples

head(P1_miRNA_rpm)
#               sequence    Brapa.1    Brapa.2    Brapa.3
#1 TTTGGATTGAAGGGAGCTCTA    1641.18    1116.03    1014.37
#2 TGAAGCTGCCAGCATGATCTA     129.33     103.23     103.68
#3 TTTCCAAATGTAGACAAAGCA     905.23     920.57    1180.51
#4 TCGGACCAGGCTTCATCCCCC      24.71      14.38      15.03
#5 AGAATCTTGATGATGCTGCAG      48.64      41.09      41.60
#6 TTGACAGAAGAAAGAGAGCAC      86.96      81.23      67.41

ExpGenetic documentation built on Sept. 9, 2022, 9:06 a.m.