F1_miRNA_rpm: RPM table of miRNAs in F1 (F1: the polyploid progeny).
In ExpGenetic: Non-Additive Expression Analysis of Hybrid Offspring
F1_miRNA_rpm R Documentation
RPM table of miRNAs in F1 (F1: the polyploid progeny).
Description
RPM table of miRNAs in F1 species. The "F1" represents the polyploid progeny.
Examples
head(F1_miRNA_rpm)
# sequence BF1.1 BF1.2 BF1.3
#1 TTTGGATTGAAGGGAGCTCTA 1512.16 1086.35 2032.97
#2 TTTCCAAATGTAGACAAAGCA 1487.94 877.01 1953.27
#3 TCCCAAATGTAGACAAAGC 6.13 5.61 12.51
#4 CTTTGTCTATCGTTTGGAAAAG 176.90 176.86 389.17
#5 TTGGACTGAAGGGAGCTCCTT 2.54 1.53 2.55
#6 TCGGACCAGGCTTCATTCCCC 245.21 103.23 156.62
ExpGenetic documentation built on Sept. 9, 2022, 9:06 a.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
| F1_miRNA_rpm | R Documentation |
RPM table of miRNAs in F1 (F1: the polyploid progeny).
Description
RPM table of miRNAs in F1 species. The "F1" represents the polyploid progeny.
Examples
head(F1_miRNA_rpm) # sequence BF1.1 BF1.2 BF1.3 #1 TTTGGATTGAAGGGAGCTCTA 1512.16 1086.35 2032.97 #2 TTTCCAAATGTAGACAAAGCA 1487.94 877.01 1953.27 #3 TCCCAAATGTAGACAAAGC 6.13 5.61 12.51 #4 CTTTGTCTATCGTTTGGAAAAG 176.90 176.86 389.17 #5 TTGGACTGAAGGGAGCTCCTT 2.54 1.53 2.55 #6 TCGGACCAGGCTTCATTCCCC 245.21 103.23 156.62
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.