Nothing
## ----setting------------------------------------------------------------------
wd <- "~"
knitr::opts_chunk$set(collapse = TRUE,
fig.width = 12,
fig.height = 8,
echo = TRUE,
warning = FALSE,
message = TRUE,
comment = "#>")
options(rmarkdown.html_vignette.check_title = FALSE,
show.error.messages = FALSE,
warn = -1)
progress_bar <- "N"
## ----packages-----------------------------------------------------------------
library(MicroSEC)
## ----analysis-----------------------------------------------------------------
# initialize
msec <- NULL
homology_search <- NULL
mut_depth <- NULL
# test data
sample_name <- "sample"
read_length <- 150
adapter_1 <- "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"
adapter_2 <- "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"
organism <- "hg38"
# load mutation information
df_mutation <- fun_load_mutation(
system.file("extdata", "mutation_list.tsv", package = "MicroSEC"),
"sample",
BSgenome.Hsapiens.UCSC.hg38::BSgenome.Hsapiens.UCSC.hg38,
24)
df_bam <- fun_load_bam(
system.file("extdata", "sample.bam", package = "MicroSEC"))
# another example data
# data(exampleMutation)
# data(exampleBam)
# df_mutation <- exampleMutation
# df_bam <- exampleBam
# load genomic sequence
ref_genome <- fun_load_genome(organism)
chr_no <- fun_load_chr_no(organism)
# analysis
result <- fun_read_check(df_mutation = df_mutation,
df_bam = df_bam,
ref_genome = ref_genome,
sample_name = sample_name,
read_length = read_length,
adapter_1 = adapter_1,
adapter_2 = adapter_2,
short_homology_search_length = 4,
min_homology_search = 40,
progress_bar = progress_bar)
msec_read_checked <- result[[1]]
homology_searched <- result[[2]]
mut_depth_checked <- result[[3]]
# search homologous sequences
msec_homology_searched = fun_homology(msec = msec_read_checked,
df_distant = homology_searched,
min_homology_search = 40,
ref_genome = ref_genome,
chr_no = chr_no,
progress_bar = progress_bar)
# statistical analysis
msec_summarized <- fun_summary(msec_homology_searched)
msec_analyzed <- fun_analysis(msec = msec_summarized,
mut_depth = mut_depth_checked,
short_homology_search_length = 4,
min_homology_search = 40,
threshold_p = 10 ^ (-6),
threshold_hairpin_ratio = 0.50,
threshold_short_length = 0.75,
threshold_distant_homology = 0.15,
threshold_soft_clip_ratio = 0.50,
threshold_low_quality_rate = 0.1,
homopolymer_length = 15)
# save the results as a tsv.gz file.
#fun_save(msec_analyzed, "~/MicroSEC_test.tsv.gz")
## ----result-------------------------------------------------------------------
msec_analyzed
## ----sessioninfo--------------------------------------------------------------
sessionInfo()
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.