swarm_clustering: Re-cluster sequences of an object of class 'physeq' or...

In MiscMetabar: Miscellaneous Functions for Metabarcoding Analysis

Re-cluster sequences of an object of class physeq or cluster a list of DNA sequences using SWARM

Description

A wrapper of SWARM software.

Usage

swarm_clustering(
  physeq = NULL,
  dna_seq = NULL,
  d = 1,
  swarmpath = "swarm",
  vsearch_path = find_vsearch(),
  nproc = 1,
  fastidious = TRUE,
  swarm_args = "",
  tax_adjust = 0,
  rank_propagation = FALSE,
  return_swarm_df = FALSE,
  keep_temporary_files = FALSE
)

Arguments

physeq	(required) a phyloseq-class object obtained using the phyloseq package.
dna_seq	NOT WORKING FOR THE MOMENT You may directly use a character vector of DNA sequences in place of physeq args. When physeq is set, dna sequences take the value of physeq@refseq
d	(default: 1) maximum number of differences allowed between two amplicons, meaning that two amplicons will be grouped if they have d (or less) differences
swarmpath	(default: swarm) path to swarm
vsearch_path	(default: vsearch) path to vsearch, used only if physeq is NULL and dna_seq is provided.
nproc	(default: 1) Set to number of cpus/processors to use for the clustering
fastidious	(logical, default TRUE), perform a second clustering pass to reduce the number of small clusters (recommended option by swarm authors). Not that if d is different from 1, fastidious is automatically set to FALSE.
swarm_args	a one length character element defining other parameters to passed on to swarm (e.g. "–mismatch-penalty 4"). See other possible methods in the SWARM pdf manual
tax_adjust	(Default 0) See the man page of merge_taxa_vec() for more details. To conserved the taxonomic rank of the most abundant ASV, set tax_adjust to 0 (default). For the moment only tax_adjust = 0 is robust.
rank_propagation	(logical, default FALSE). Do we propagate the NA value from lower taxonomic rank to upper rank? See the man page of merge_taxa_vec() for more details.
return_swarm_df	(logical, default FALSE) Do we return the swarm dataframe instead of the phyloseq object ? Default FALSE return a phyloseq object if physeq is provided.
keep_temporary_files	(logical, default: FALSE) Do we keep temporary files ? temp.fasta (refseq in fasta or dna_seq sequences) temp_output (classical output of SWARM) temp_uclust (clusters output of SWARM)

Details

This function use the merge_taxa_vec function to merge taxa into clusters. By default tax_adjust = 0 and rank_propagation = FALSE. See the man page of merge_taxa_vec().

This function is mainly a wrapper of the work of others. Please cite SWARM.

Value

A new object of class physeq or a list of cluster if dna_seq args was used or if return_swarm_df was set to TRUE.

References

SWARM can be downloaded from https://github.com/torognes/swarm/.

SWARM can be downloaded from https://github.com/torognes/swarm. More information in the associated publications \Sexpr[results=rd]{tools:::Rd_expr_doi("doi:10.1093/bioinformatics/btab493")} and \Sexpr[results=rd]{tools:::Rd_expr_doi("doi:10.7717/peerj.593")}

See Also

postcluster_pq(), vsearch_clustering()

Examples

summary_plot_pq(data_fungi)
system2("swarm", "-h")

data_fungi_swarm <- swarm_clustering(data_fungi)
summary_plot_pq(data_fungi_swarm)

sequences_ex <- c(
  "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA",
  "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT",
  "TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG",
  "TACCTATGTTGCCTTGGCGGCTAAACCTACC",
  "CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG",
  "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG",
  "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
  "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
  "GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG"
)

sequences_ex_swarm <- swarm_clustering(
  dna_seq = sequences_ex
)

MiscMetabar documentation built on June 8, 2026, 5:07 p.m.