| vs_search_global | R Documentation |
Use of VSEARCH software.
vs_search_global(
physeq,
path_to_fasta = NULL,
seq2search = NULL,
vsearchpath = find_vsearch(),
id = 0.8,
iddef = 0,
keep_temporary_files = FALSE
)
physeq |
(required) a |
path_to_fasta |
(required if seq2search is NULL) a path to fasta file if seq2search is est to NULL. |
seq2search |
(required if path_to_fasta is NULL) Either (i) a DNAStringSet object
or (ii) a character vector that will be convert to DNAStringSet using
|
vsearchpath |
(default: |
id |
(default: 0.8) id for the option |
iddef |
(default: 0) iddef for the option |
keep_temporary_files |
(logical, default: FALSE) Do we keep temporary files
|
This function is mainly a wrapper of the work of others. Please cite vsearch.
A dataframe with uc results (invisible)
Adrien Taudière
if (requireNamespace("seqinr")) {
file_dna <- tempfile("dna.fa")
seqinr::write.fasta("GCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTTCAACC",
file = file_dna, names = "seq1"
)
res <- vs_search_global(data_fungi, path_to_fasta = file_dna)
unlink(file_dna)
res[res$identity != "*", ]
clean_pq(subset_taxa(data_fungi, res$identity != "*"))
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.