consensus.pyRAD: Generate a consensus sequence for each of the loci in a...

In RADami: Phylogenetic Analysis of RADseq Data

Description

Uses consensusString [S4 method for signature 'DNAStringSet'] from the Biostrings package to create a consensus sequence for each locus in a pyRAD.loci object. All options in consensusString can be passed in. As a side-effect, writes a fasta-style file to writeFile.

Usage

consensus.pyRAD(pyIn, from = NA, to = NA, fastaNames = T,
    writeFile = 'rads.con.txt', cores = 1, ...)

Arguments

pyIn	an object of class pyRAD.loci
from	first locus to summarize (by number, sequentially from the beginning of the file), or NA if all loci are to be used
to	last locus to summarize (by number, sequentially from the beginning of the file), or NA if all loci are to be used
fastaNames	use TRUE to append a > to the front of each sequence title, making a fasta- style file
writeFile	filename to which to write the sequences
cores	number of cores to use; requires the parallel package
...	extra arguments to consensusString

Value

A character vector of sequences, with locus names as the vector names.

Author(s)

Andrew Hipp

Examples

  data(oak.rads)
  # provide filename for export in line below
  temp = consensus.pyRAD(oak.rads, from=1, to = 10, writeFile = NA)
  temp

Example output

Loading required package: ape
                                             >locus.1 
 "AGATCTCACCTGRTATGACATTAGTCTTGCTATCCTTAAACATTAATGAG" 
                                             >locus.2 
 "GCTGAGTGATGTAAATAAATTAGAGAAATTTATCAARATGAAAGGGAAAC" 
                                             >locus.3 
 "GTAAAAGAGAATGAGTCTGCTCTCTTGCCTTATACCGAACTCGACTCTCC" 
                                             >locus.4 
 "TTCTTCTTCGCTCTGCATCCTTTTTGTCCAATGCTTCTAATCTACGTTTA" 
                                             >locus.5 
 "CTTTTGTTTTTCTTCTTCACTTGTTGCCGCCTTTATTTTCCTATTAAAAA" 
                                             >locus.6 
 "CGTTATGGTTGATTTAGAAGAGGAAGAAAAGAAGGAAATGGTTCTCTGYC" 
                                             >locus.7 
 "TGTAACCAGGTTGAAGCTTAATGGAGGCACCAAAGTAGCCAGATCGAAAT" 
                                             >locus.8 
 "TGTCATTGGAATGGGGGTAAAGTAGTAAGAAAATAGAGGGTTACTTCAKT" 
                                             >locus.9 
 "AGRTTGGTGGAGGAAGAGGGTTGCTCGGTTTCGGAGCCCGATTCACTCGG" 
                                            >locus.10 
"TGCTAGGCTAGTCTTCCTGNTTAAAAAGGACAAATTGGCAATTTGGGTGCG" 

RADami documentation built on May 30, 2017, 8:23 a.m.