RNAPlot: Generic RNA Secondary Structure Plotting Function
In RRNA: Secondary Structure Plotting for RNA

Description Usage Arguments Value Author(s) See Also Examples

Given fold data from loadFolds or ct2coords RNAPlot plots the secondary structure

RNAPlot(data, ranges = 0, add = FALSE, hl = NULL, seqcols = NULL,
        seqTF = FALSE, labTF = FALSE, nt = FALSE, dp = 0.5,
        modspec = FALSE, modp = NULL, mod = NULL, modcol = NULL,
        tsize = 0.5, main = "", pointSize = 2, lineWd = 2)

`data`	R data frame containing the coordinates for plotting a given secondary structure ### Example input file format: ### ### 0,158.534088,199.550888,G,0,-1 ### 0,152.741776,194.100571,A,1,-1 ### 0,149.307266,186.849899,A,2,-1 ### 0,148.749847,178.776566,G,3,-1 ### 0,151.196960,170.989944,C,4,59 ### 0,141.412643,159.620361,U,5,58 ### 0,131.628342,148.250793,U,6,57 ### 0,121.844025,136.881210,A,7,56 ### 0,112.059715,125.511642,C,8,55 ### 0,102.275398,114.142059,A,9,54 ### 0,89.142853,109.343330,A,10,-1 ### .... ### ### There is no header on the input file. The columns are ### ID,X,Y,SEQ,POS,BOUND ### ### ID - A unique ID for a given fold in the file ### X - X position of the NT in the secondary structure plot ### Y - Y position of the NT in the secondary structure plot ### SEQ - The nucleotide (A,G,U,C) ### POS - The position of the NT in the sequence ### BOUND - The position of the NT that the NT at POS is bound to
`ranges`	A data frame containing the ranges of sequence positions that should be highlighted with given colors. `ranges=data.frame(min=c(69,1,7),max=c(74,5,17),col=c(2,3,4),desc=c("Region 1","Region 2","Region 3"))` The above will highlight the nucleotides at positions 69-74, 1-5, and 7-17 respectively
`add`	Should the new plot be added to an existing plot TRUE/FALSE
`hl`	Takes an array of sequences and highlights them with seqcol `hl=c("GGGAAAA","GGGCCCC")` The above hl will highlight the nucleotides in the secondary structure that have the given sequences with the colors provided in the seqcols option.
`seqcols`	Colors that should be used to highlight the sequences given in hl
`seqTF`
`labTF`	TRUE/FALSE plot the legend
`nt`	TRUE/FALSE plot the nucleotide sequence on the secondary structure
`dp`	Floating point value to determine how far from the coordinates the nucleotide sequence should be plotted. Values between 0 and 5 usually work best.
`modspec`	TRUE/FALSE modify specific positions in the secondary structure. Used in combination with modp,mod,and modcol. This allows you to change the shape and color of nucleotide in the secondary structure.
`modp`	Array defining the specific positions to be modified in the plot `modp=c(1:10)`
`mod`	Array defining the pch values to be plotted at the positions given by modp. `mod=c(rep(15,5),rep(16,5))`
`modcol`	Array of color values to be used for plotting at the positions defined by modp in the secondary structure. `modcol=rep(4,10)`
`tsize`	Text size used for plotting the nucleotide sequence in the secondary structure. Only applicable when nt=TRUE. Values between 0.1 and 4 work well.
`main`	Title used for the plot when labTF is set to TRUE.
`pointSize`	The size of points plotted in the secondary structure. Values betwen 0.1-5 work well.
`lineWd`	Line width for base pairings and backbone of secondary structures.

Returns a generic R plot that can be used with the jpeg, postscript, etc. functions.

JP Bida

makeCt,loadCoords,ct2coord

## Create a CT file from bracket notation and sequence ###
ct=makeCt( "((((...(((((((....)))))))...((((...))))...))))",
          "CCCCAAAGGGGGGGAUUACCCCUCCUUUAAAAGGGUUUUCCCCCCC"
)

## Create a coordinate file based on the CT file ###
dat=ct2coord(ct)

### Create a plot of the secondary structure ###
RNAPlot(dat)

### Plot positions 1:4 as green and 43:46 circles ## 
### and show the legend
ranges=data.frame(min=c(1,43),max=c(4,46),col=c(2,3),
                  desc=c("Region 1","Region 2")
                 )
RNAPlot(dat,ranges,labTF=TRUE)

### Highlight the sequences CUCCU and CCCCAAA ###

RNAPlot(dat,hl=c("CUCCU","CCCCAAA"),seqcol=c(2,4),labTF=TRUE,main="RNA Molecule")

### Modify specific positions ####

RNAPlot( dat, modspec=TRUE, modp=c(1:4,43:46),mod=c(17,17,15,15,16,16,16,16),
         modcol=c(rep(2,2),rep(3,2),rep(4,4))
       )

### RNA Plot with nucleotides ###
RNAPlot(dat,nt=TRUE)

### RNA plot with nucleotides
RNAPlot( dat,nt=TRUE,modspec=TRUE,modp=c(1:4,43:46),
         mod=c(17,17,15,15,16,16,16,16),
         modcol=c(rep(2,2),rep(3,2),rep(4,4))
       )

### RNA Plot wiht nucleotides and dots ###

RNAPlot(dat)
RNAPlot(dat,nt=TRUE,add=TRUE,dp=0.75)