aptPlotCT: RNA secondary structure plotting from CT files
In RRNA: Secondary Structure Plotting for RNA

Description Usage Arguments Value Author(s) See Also Examples

Generates and RNA secondary structure plot from a CT file. Removes pseudoKnots automatically and allows them to be drawn back in with pseudoTF=TRUE.

aptPlotCT(file, ranges = 0, add = FALSE, hl = NULL, seqcols = NULL,
          seqTF = FALSE, labTF = FALSE, nt = FALSE, dp = 0.5, 
          modspec = FALSE, modp = NULL, mod = NULL, modcol = NULL, 
          tsize = 0.5, main = "", pseudoTF = FALSE, pseudo_nums = NULL, 
          ticks = NULL, ticksTF = FALSE
         )

`file`	CT file name
`ranges`	A data frame containing the ranges of sequence positions that should be highlighted with given colors. `ranges=data.frame(min=c(69,1,7),max=c(74,5,17),col=c(2,3,4),desc=c("Region 1","Region 2","Region 3"))` The above will highlight the nucleotides at positions 69-74, 1-5, and 7-17 respectively
`add`	Should the new plot be added to an existing plot TRUE/FALSE
`hl`	Takes an array of sequences and highlights them with seqcol `hl=c("GGGAAAA","GGGCCCC")` The above hl will highlight the nucleotides in the secondary structure that have the given sequences with the colors provided in the seqcols option.
`seqcols`	Colors that should be used to highlight the sequences given in hl
`seqTF`
`labTF`	TRUE/FALSE plot the legend
`nt`	TRUE/FALSE plot the nucleotide sequence on the secondary structure
`dp`	Floating point value to determine how far from the coordinates the nucleotide sequence should be plotted. Values between 0 and 5 usually work best.
`modspec`	TRUE/FALSE modify specific positions in the secondary structure. Used in combination with modp,mod,and modcol. This allows you to change the shape and color of nucleotide in the secondary structure.
`modp`	Array defining the specific positions to be modified in the plot `modp=c(1:10)`
`mod`	Array defining the pch values to be plotted at the positions given by modp. `mod=c(rep(15,5),rep(16,5))`
`modcol`	Array of color values to be used for plotting at the positions defined by modp in the secondary structure. `modcol=rep(4,10)`
`tsize`	Text size used for plotting the nucleotide sequence in the secondary structure. Only applicable when nt=TRUE. Values between 0.1 and 4 work well.
`main`	Title used for the plot when labTF is set to TRUE.
`pseudoTF`	Plot pseudo knot sequences
`pseudo_nums`	indices of the nucleotides included in pseudoknots
`ticksTF`	TRUE/FALSE include ticks
`ticks`	Positions where the ticks should be drawn. These are sequence positions in the RNA molecule

Returns and R plot object

JP Bida

RNAPlot

### PseudoKnots ###
pk= makeCt("((((...(((((((.........)))))))...((((.........))))...))))",
          "AAAAAAAACCCCCCCCAAAGGGGGGGAUUACCCCUCCUUUAAAAGGGUUUUCCCCCCC"
         )
pk$bound[pk$pos==20]=42
pk$bound[pk$pos==19]=43
pk$bound[pk$pos==43]=19
pk$bound[pk$pos==42]=20

### Create a CT file for testing ###
write.table(pk[,c(1,4,2,3,6,5)],file="test.ct",row.names=FALSE,col.names=TRUE)

aptPlotCT("test.ct",ticksTF=TRUE,ticks=seq(1,60,by=5),pseudoTF=TRUE,pseudo_nums=c(19,20,43,42))