slide_codon: Generate sliding windows for codon-level analysis

In cubar: Codon Usage Bias Analysis

Generate sliding windows for codon-level analysis

Description

slide_codon creates sliding window intervals specifically designed for codon-based analysis of DNA sequences. This function automatically handles codon boundaries and is useful for studying positional effects in codon usage within genes.

Usage

slide_codon(seq, step = 1, before = 0, after = 0)

Arguments

seq	A DNA sequence as a DNAString object, or any object that can be coerced to DNAString.
step	Integer specifying the step size between consecutive window centers in codons (default: 1). A step of 3 creates non-overlapping windows.
before	Integer specifying the number of codons to include before the window center (default: 0).
after	Integer specifying the number of codons to include after the window center (default: 0).

Value

A data.table with three columns containing nucleotide positions:

• start: Start nucleotide position of each window

• center: Center nucleotide position of each window

• end: End nucleotide position of each window

Examples

# Create sliding windows for codon analysis
x <- Biostrings::DNAString('ATCTACATAGCTACGTAGCTCGATGCTAGCATGCATCGTACGATCGTCGATCGTAG')
slide_codon(x, step = 3, before = 1, after = 1)

cubar documentation built on Aug. 21, 2025, 5:40 p.m.