search_primer_pair: Automatic primer searching Search a given primer pair,...

In primerTree: Visually Assessing the Specificity and Informativeness of Primer Pairs

Automatic primer searching Search a given primer pair, retrieving the alignment results, their product sequences, the taxonomic information for the sequences, a multiple alignment of the products

Description

Automatic primer searching Search a given primer pair, retrieving the alignment results, their product sequences, the taxonomic information for the sequences, a multiple alignment of the products

Usage

search_primer_pair(
  forward,
  reverse,
  name = NULL,
  num_aligns = 500,
  num_permutations = 25,
  simplify = TRUE,
  clustal_options = list(),
  distance_options = list(model = "N", pairwise.deletion = T),
  api_key = Sys.getenv("NCBI_API_KEY"),
  ...,
  .parallel = FALSE,
  .progress = "none"
)

Arguments

forward	forward primer to search by 5'-3' on plus strand
reverse	reverse primer to search by 5'-3' on minus strand
name	name to give to the primer pair
num_aligns	number of alignment results to keep
num_permutations	the number of primer permutations to search, if the degenerate bases cause more than this number of permutations to exist, this number will be sampled from all possible permutations.
simplify	use simple names for primer hit results or complex
clustal_options	a list of options to pass to clustal omega, see link{clustalo} for a list of options
distance_options	a list of options to pass to dist.dna, see link{dist.dna} for a list of options
api_key	NCBI api-key to allow faster sequence retrieval
...	additional arguments passed to Primer-Blast
.parallel	if 'TRUE', perform in parallel, using parallel backend provided by foreach
.progress	name of the progress bar to use, see create_progress_bar

Value

A list with the following elements,

name	name of the primer pair
BLAST_result	html blast results from Primer-BLAST as 'a response

object.

taxonomy	taxonomy for the primer products from NCBI
sequence	sequence of the primer products
alignment	multiple alignment of the primer products
tree	phylogenetic tree of the reconstructed from the 'multiple alignment

See Also

primer_search, clustalo

Examples

## Not run: 
#simple search
mammals_16S = search_primer_pair(name='Mammals 16S',
 'CGGTTGGGGTGACCTCGGA', 'GCTGTTATCCCTAGGGTAACT')
#returning 1000 alignments, allow up to 3 mismatches in primer
mammals_16S = search_primer_pair(name='Mammals 16S',
 'CGGTTGGGGTGACCTCGGA', 'GCTGTTATCCCTAGGGTAACT',
 num_aligns=1000, total_primer_specificity_mismatch=3)

## End(Not run)

primerTree documentation built on April 5, 2022, 5:07 p.m.