Nothing
#' The Increment Of Diversity Descriptors
#'
#' The Increment Of Diversity Descriptors
#'
#' This function calculates the The Basic Kmer Descriptor
#'
#' @param k the k value of kmer, it should be an integer larger than 0,the default value is 6.
#'
#' @param x the input data, which should be a list or file type.
#'
#' @param pos the positive source data, which should be a or type.
#'
#' @param neg the negative source data, which should be or type.
#'
#' @param upto generate all the kmers: 1mer, 2mer, ..., kmer. The output feature vector is
#' the combination of all these kmers. The default value of this parameter is True
#'
#' @return if upto is True, A length \code{k * 2} named vector, \code{k} is the k value of kmer;
#' if upto is False, A length 2 named vector
#'
#' @keywords extract the increment of diversity
#'
#' @aliases IncDiv
#'
#' @author Min-feng Zhu <\email{wind2zhu@@163.com}>
#'
#' @export make_idkmer_vec
#'
#' @seealso See \code{\link{kmer}}
#'
#' @references
#' Chen W, Luo L, Zhang L. The organization of nucleosomes around splice sites.
#' \emph{Nucleic acids research}, 2010, 38(9): 2788-2798.
#' Liu G, Liu J, Cui X, et al. Sequence-dependent prediction of recombination hotspots in
#' Saccharomyces cerevisiae. \emph{Journal of theoretical biology}, 2012, 293: 49-54.
#'
#' @examples
#'
#' pos = readFASTA(system.file('dnaseq/pos.fasta', package = 'rDNAse'))
#' neg = readFASTA(system.file('dnaseq/neg.fasta', package = 'rDNAse'))
#' x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
#' make_idkmer_vec(k = 6, x, pos, neg)
make_idkmer_vec = function (k = 6, x, pos, neg,
upto = TRUE) {
if (upto) l = 1
else l = k
ID = c()
for (j in l:k){
if (upto == F || j == 1){
temp_pos_s_vec = data.frame(lapply(pos, kmer, k=j))
temp_neg_s_vec = data.frame(lapply(neg, kmer, k=j))
temp_pos_s_vec = rowSums(temp_pos_s_vec)
temp_neg_s_vec = rowSums(temp_neg_s_vec)
}
temp_vec = lapply(x, kmer, k = j)
temp_id.pos = lapply(temp_vec, id_x_s, vec_s = temp_pos_s_vec, diversity_s = diversity(temp_pos_s_vec))
temp_id.neg = lapply(temp_vec, id_x_s, vec_s = temp_neg_s_vec, diversity_s = diversity(temp_neg_s_vec))
temp_id = mapply(c, temp_id.pos, temp_id.neg, SIMPLIFY = FALSE)
if (length(ID) == 0) {
ID = temp_id
} else {
ID = mapply(c, ID, temp_id, SIMPLIFY = FALSE)
}
}
return(ID)
}
#' diversity function for make_kmer_vec
#'
#' diversity
#'
#' @return diversity
#'
#' @keywords internal
diversity = function (vec) {
vec = vec[which(vec != 0)]
diversity = sum(vec) * log2(sum(vec)) - sum(vec * log2(vec))
return(diversity)
}
#' id_x_s function for make_kmer_vec
#'
#' id_x_s
#'
#' @return id
#'
#' @keywords internal
#'
id_x_s = function (vec_x, vec_s, diversity_s) {
vec_x_s = rowSums(data.frame(vec_x[1:length(vec_s)], vec_s))
id_x_s = diversity(vec_x_s) - diversity(vec_x) - diversity_s
return(id_x_s)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.