assembly

extractTranscriptSeqs

R Documentation

Extract transcript (or CDS) sequences from chromosome sequences

Description

extractTranscriptSeqs extracts transcript (or CDS) sequences from an object representing a single chromosome or a collection of chromosomes.

Usage

extractTranscriptSeqs(x, transcripts, ...)

## S4 method for signature 'DNAString'
extractTranscriptSeqs(x, transcripts, strand="+")

## S4 method for signature 'ANY'
extractTranscriptSeqs(x, transcripts, ...)

Arguments

`x`	An object representing a single chromosome or a collection of chromosomes. More precisely, `x` can be a DNAString object (single chromosome), or a BSgenome object (collection of chromosomes). Other objects representing a collection of chromosomes are supported (e.g. FaFile objects in the Rsamtools package) as long as `seqinfo` and `getSeq` work on them.
`transcripts`	An object representing the exon ranges of each transcript to extract. More precisely: If `x` is a DNAString object, then `transcripts` must be an IntegerRangesList object. If `x` is a BSgenome object or any object representing a collection of chromosomes, then `transcripts` must be a GRangesList object or any object for which `exonsBy` is implemented (e.g. a TxDb or EnsDb object). If the latter, then it's first turned into a GRangesList object with `exonsBy(transcripts, by="tx", ...)`. Note that, for each transcript, the exons must be ordered by ascending rank, that is, by ascending position in the transcript (when going in the 5' to 3' direction). This generally means (but not always) that they are also ordered from 5' to 3' on the reference genome. More precisely: For a transcript located on the plus strand, the exons will typically (but not necessarily) be ordered by ascending position on the reference genome. For a transcript located on the minus strand, the exons will typically (but not necessarily) be ordered by descending position on the reference genome. If `transcripts` was obtained with `exonsBy` (see above), then the exons are guaranteed to be ordered by ascending rank. See `?exonsBy` for more information.
`...`	Additional arguments, for use in specific methods. For the default method, additional arguments are allowed only when `transcripts` is not a GRangesList object, in which case they are passed to the internal call to `exonsBy` (see above).
`strand`	Only supported when `x` is a DNAString object. Can be an atomic vector, a factor, or an Rle object, in which case it indicates the strand of each transcript (i.e. all the exons in a transcript are considered to be on the same strand). More precisely: it's turned into a factor (or factor-Rle) that has the "standard strand levels" (this is done by calling the `strand` function on it). Then it's recycled to the length of IntegerRangesList object `transcripts` if needed. In the resulting object, the i-th element is interpreted as the strand of all the exons in the i-th transcript. `strand` can also be a list-like object, in which case it indicates the strand of each exon, individually. Thus it must have the same shape as IntegerRangesList object `transcripts` (i.e. same length plus `strand[[i]]` must have the same length as `transcripts[[i]]` for all `i`). `strand` can only contain `"+"` and/or `"-"` values. `"*"` is not allowed.

Value

A DNAStringSet object parallel to transcripts, that is, the i-th element in it is the sequence of the i-th transcript in transcripts.

Author(s)

Hervé Pagès

Examples

## ---------------------------------------------------------------------
## 1. A TOY EXAMPLE
## ---------------------------------------------------------------------

library(Biostrings)

## A chromosome of length 30:
x <- DNAString("ATTTAGGACACTCCCTGAGGACAAGACCCC")

## 2 transcripts on 'x':
tx1 <- IRanges(1, 8)            # 1 exon
tx2 <- c(tx1, IRanges(12, 30))  # 2 exons
transcripts <- IRangesList(tx1=tx1, tx2=tx2)
extractTranscriptSeqs(x, transcripts)

## By default, all the exons are considered to be on the plus strand.
## We can use the 'strand' argument to tell extractTranscriptSeqs()
## to extract them from the minus strand.

## Extract all the exons from the minus strand:
extractTranscriptSeqs(x, transcripts, strand="-")

## Note that, for a transcript located on the minus strand, the exons
## should typically be ordered by descending position on the reference
## genome in order to reflect their rank in the transcript:
extractTranscriptSeqs(x, IRangesList(tx1=tx1, tx2=rev(tx2)), strand="-")

## Extract the exon of the 1st transcript from the minus strand:
extractTranscriptSeqs(x, transcripts, strand=c("-", "+"))

## Extract the 2nd exon of the 2nd transcript from the minus strand:
extractTranscriptSeqs(x, transcripts, strand=list("-", c("+", "-")))

## ---------------------------------------------------------------------
## 2. A REAL EXAMPLE
## ---------------------------------------------------------------------

## Load a genome:
library(BSgenome.Hsapiens.UCSC.hg19)
genome <- BSgenome.Hsapiens.UCSC.hg19

## Load a TxDb object:
txdb_file <- system.file("extdata", "hg19_knownGene_sample.sqlite",
                         package="GenomicFeatures")
txdb <- loadDb(txdb_file)

## Check that 'txdb' is based on the hg19 assembly:
txdb

## Extract the exon ranges grouped by transcript from 'txdb':
transcripts <- exonsBy(txdb, by="tx", use.names=TRUE)

## Extract the transcript sequences from the genome:
tx_seqs <- extractTranscriptSeqs(genome, transcripts)
tx_seqs

## A sanity check:
stopifnot(identical(width(tx_seqs), unname(sum(width(transcripts)))))

## Note that 'tx_seqs' can also be obtained with:
extractTranscriptSeqs(genome, txdb, use.names=TRUE)

## ---------------------------------------------------------------------
## 3. USING extractTranscriptSeqs() TO EXTRACT CDS SEQUENCES
## ---------------------------------------------------------------------

cds <- cdsBy(txdb, by="tx", use.names=TRUE)
cds_seqs <- extractTranscriptSeqs(genome, cds)
cds_seqs

## A sanity check:
stopifnot(identical(width(cds_seqs), unname(sum(width(cds)))))

## Note that, alternatively, the CDS sequences can be obtained from the
## transcript sequences by removing the 5' and 3' UTRs:
tx_lens <- transcriptLengths(txdb, with.utr5_len=TRUE, with.utr3_len=TRUE)
stopifnot(identical(tx_lens$tx_name, names(tx_seqs)))  # sanity
## Keep the rows in 'tx_lens' that correspond to a sequence in 'cds_seqs'
## and put them in the same order as in 'cds_seqs':
m <- match(names(cds_seqs), names(tx_seqs))
tx_lens <- tx_lens[m, ]
utr5_width <- tx_lens$utr5_len
utr3_width <- tx_lens$utr3_len
cds_seqs2 <- narrow(tx_seqs[m],
                    start=utr5_width+1L, end=-(utr3_width+1L))
stopifnot(identical(as.character(cds_seqs2), as.character(cds_seqs)))

## ---------------------------------------------------------------------
## 4. TRANSLATE THE CDS SEQUENCES
## ---------------------------------------------------------------------

prot_seqs <- translate(cds_seqs, if.fuzzy.codon="solve")

## Note that, by default, translate() uses The Standard Genetic Code to
## translate codons into amino acids. However, depending on the organism,
## a different genetic code might be needed to translate CDS sequences
## located on the mitochodrial chromosome. For example, for vertebrates,
## the following code could be used to correct 'prot_seqs':
SGC1 <- getGeneticCode("SGC1")
chrM_idx <- which(all(seqnames(cds) == "chrM"))
prot_seqs[chrM_idx] <- translate(cds_seqs[chrM_idx], genetic.code=SGC1,
                                 if.fuzzy.codon="solve")

Bioconductor/GenomicFeatures documentation built on Nov. 7, 2024, 4:25 a.m.