changeSequenceHZEI: Adjust HZEI integral of nucleotide sequence

In caggtaagtat/ModCon: Modifying splice site usage by changing the mRNP code, while maintaining the genetic code

Description

Adjust the HZEI integral of a nucleotide sequence (min. 24nt long)

Usage

changeSequenceHZEI(inSeq, increaseHZEI=TRUE, nGenerations=50, parentSize=300,
startParentSize=1000, bestRate=50, semiLuckyRate=20, luckyRate=5, mutationRate=1e-04,
optiRate=100, sdMaximalHBS=10, acMaximalMaxent=4, nCores=-1)

Arguments

inSeq	Character value of nucleotide sequence (min 24nt long, only bases A, G, T or C)
increaseHZEI	Logical value if HZEI integral should be increased or decreased during SD degradation. If TRUE, function aims to increase HZEI integral.
nGenerations	Numeric value setting maximal number of generations
parentSize	Numeric value setting size of parent generations, generated from previous generations
startParentSize	Numeric value setting size of initiated parent generation of sequences
bestRate	Numeric value setting percentage how many of the fittest sequences are used to produce the next generation
semiLuckyRate	Numeric value setting percentage of sequences which are selected for breeding with a probability based on the respective HZEI-score integral
luckyRate	Numeric value setting percentage of sequences which are randomly selected for breeding
mutationRate	Numeric value setting chance of each codon, to mutate randomly within a child sequence
optiRate	Numeric value setting level of HZEI integral optimization
sdMaximalHBS	Numeric value of minimal HBS of SDs which should be tried to be degraded in their intrinsic strength
acMaximalMaxent	Numeric value of minimal MaxEntScan score of SAs which should be tried to be degraded in their intrinsic strength
nCores	Numeric value setting number of cores which should be used for parallel computations. If set to '-1' all availible cores are selected.

Value

Character value of a nucleotide sequence encoding the same amino acid sequence as inSeq, but an increased HZEI integral, due to alternative codon selection.

Examples

## Load R packages
library('parallel')
library('utils')
library('data.table')

## Set parameters for genetic algorithm
inSeq <- 'ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACC'

## Increase HZEI integral
res <- changeSequenceHZEI(inSeq)

## Setting additional parameters
res <- changeSequenceHZEI(inSeq, increaseHZEI=TRUE, nGenerations=50, parentSize=300,
startParentSize=1000, bestRate=50, semiLuckyRate=20, luckyRate=5, mutationRate=1e-04,
optiRate=100, sdMaximalHBS=10, acMaximalMaxent=4, nCores=1)

## Access sequence with highest generated HZEI intregral
res[[3]]

caggtaagtat/ModCon documentation built on March 12, 2021, 4:12 a.m.