selectBestAndMean: Select best HZEI and mean

In caggtaagtat/ModCon: Modifying splice site usage by changing the mRNP code, while maintaining the genetic code

Description

From all sequences of a generation report highest HZEI integral and mean HZEI integral of all.

Usage

selectBestAndMean(sequenceVector, clusterName, increaseHZEI=TRUE)

Arguments

sequenceVector	Character vector of nucleotide sequences
clusterName	Name of cluster generated with package parallel
increaseHZEI	Logical value if HZEI integral should be increased or decreased during SD degradation. If TRUE, function aims to increase HZEI integral.

Value

Numeric vector of length 2 stating the best HZEI integral and the mean HZEI integral of a nucleotide sequence vector sequenceVector. Depending on the increaseHZEI mode, the best HZEI integral value is either the highest (for increaseHZEI==TRUE) or lowest (for increaseHZEI==FALSE).

Examples

## Setup cluster
library(parallel)
nCores <- 1
clust <- makeCluster(nCores)
clusterExport(clust, list('getOverlappingVectorsFromVector', 'hex',
'calculateHZEIint'), envir = environment())
selectBestAndMean(c('CGCGATACGCTAAGCGCTACCGATAGTGGA','TGGGATATTTTAAGCGCTGACGATAGTGGA'),
clust, increaseHZEI=TRUE)

caggtaagtat/ModCon documentation built on March 12, 2021, 4:12 a.m.