Description Usage Arguments Value Examples
View source: R/mutatePopulation.R
For every codon within a set of nucleotide sequences randomly exchange the codon encoding the same amino acid to a certain chance.
1 | mutatePopulation(sequenceVector, codonReplacementChance)
|
sequenceVector |
Character vector of nucleotide sequences (at least 3 nt long) |
codonReplacementChance |
Numeric value of chance of a codons within the sequences to get exchanged to another codon encoding the same amino acid |
Creates a character vector of coding nucleotide sequences encoding the same amino acid sequence as the entered sequenceVector
. By a mutation rate stated in codonReplacementChance
, codons are randomly exchanged, by alternative codons encoding the same amino acid.
1 | mutatePopulation(c("CGCGATACGCTAAGCGCTACCGATAGTGGA","TGGGATATTTTAAGCGCTGACGATAGTGGA"), 0.1)
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.