Description Usage Arguments Value Examples
View source: R/calculateHZEIperNT.R
This function generates a table with HZEI scores per index nucleotide.
| 1 | 
| seq | Nucleotide sequence longer than 11nt and only containing bases "A", "G", "C", "T". | 
Dataframe with HZEI value per index position.
| 1 | calculateHZEIperNT("TTCCAAACGAACTTTTGTAGGGA")
 | 
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.