Description Usage Arguments Value Examples
View source: R/getMaxEntInfo.R
This function generates a table with MaxEntScan scores per potential SA position.
1 |
seq |
Nucleotide sequence longer than 22nt and only containing bases "A", "G", "C", "T". |
Dataframe of potential acceptor index positons and corresponding MaxEntScan scores.
1 | getMaxEntInfo("TTCCAAACGAACTTTTGTAGGGA")
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.