tests/testthat/_snaps/correlation.md
In cancerit/RCRISPR: R Functions for CRISPR-Related Analyses
can plot correlation
Code
p$data
Output
sgRNA gene HELA_T0 HELA_T15A_CTRL HELA_T15B_CTRL
1 A1BG_CACCTTCGAGCTGCTGCGCG A1BG 478 519 439
2 A1BG_AAGAGCGCCTCGGTCCCAGC A1BG 0 0 0
3 A1BG_TGGACTTCCAGCTACGGCGC A1BG 274 193 163
HELA_T15C_CTRL HELA_T15A_OLA HELA_T15B_OLA HELA_T15C_OLA
1 587 389 591 274
2 52 0 16 0
3 161 80 393 45
Code
p$gg
Output
$theme
List of 97
$ line :List of 6
..$ colour : chr "black"
..$ linewidth : num 0.5
..$ linetype : num 1
..$ lineend : chr "butt"
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ rect :List of 5
..$ fill : chr "white"
..$ colour : chr "black"
..$ linewidth : num 0.5
..$ linetype : num 1
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ text :List of 11
..$ family : chr ""
..$ face : chr "plain"
..$ colour : chr "black"
..$ size : num 11
..$ hjust : num 0.5
..$ vjust : num 0.5
..$ angle : num 0
..$ lineheight : num 0.9
..$ margin : 'margin' num [1:4] 0points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ title : NULL
$ aspect.ratio : NULL
$ axis.title : NULL
$ axis.title.x :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 2.75points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.x.top :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 2.75points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.x.bottom : NULL
$ axis.title.y :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 1
..$ angle : num 90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 2.75points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.y.left : NULL
$ axis.title.y.right :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : num -90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 0points 2.75points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : chr "grey30"
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 1
..$ vjust : num 0.5
..$ angle : num 90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 2.2points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x.top :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 2.2points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x.bottom : NULL
$ axis.text.y :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 1
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 2.2points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.y.left : NULL
$ axis.text.y.right :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 0points 2.2points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.ticks :List of 6
..$ colour : chr "grey70"
..$ linewidth : 'rel' num 0.5
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ axis.ticks.x : NULL
$ axis.ticks.x.top : NULL
$ axis.ticks.x.bottom : NULL
$ axis.ticks.y : NULL
$ axis.ticks.y.left : NULL
$ axis.ticks.y.right : NULL
$ axis.ticks.length : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
$ axis.ticks.length.x : NULL
$ axis.ticks.length.x.top : NULL
$ axis.ticks.length.x.bottom: NULL
$ axis.ticks.length.y : NULL
$ axis.ticks.length.y.left : NULL
$ axis.ticks.length.y.right : NULL
$ axis.line : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ axis.line.x : NULL
$ axis.line.x.top : NULL
$ axis.line.x.bottom : NULL
$ axis.line.y : NULL
$ axis.line.y.left : NULL
$ axis.line.y.right : NULL
$ legend.background :List of 5
..$ fill : NULL
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ legend.margin : 'margin' num [1:4] 5.5points 5.5points 5.5points 5.5points
..- attr(*, "unit")= int 8
$ legend.spacing : 'simpleUnit' num 11points
..- attr(*, "unit")= int 8
$ legend.spacing.x : NULL
$ legend.spacing.y : NULL
$ legend.key :List of 5
..$ fill : chr "white"
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ legend.key.size : 'simpleUnit' num 1.2lines
..- attr(*, "unit")= int 3
$ legend.key.height : NULL
$ legend.key.width : NULL
$ legend.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ legend.text.align : NULL
$ legend.title :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ legend.title.align : NULL
$ legend.position : chr "right"
$ legend.direction : NULL
$ legend.justification : chr "center"
$ legend.box : NULL
$ legend.box.just : NULL
$ legend.box.margin : 'margin' num [1:4] 0cm 0cm 0cm 0cm
..- attr(*, "unit")= int 1
$ legend.box.background : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ legend.box.spacing : 'simpleUnit' num 11points
..- attr(*, "unit")= int 8
$ panel.background :List of 5
..$ fill : chr "white"
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ panel.border :List of 5
..$ fill : logi NA
..$ colour : chr "grey70"
..$ linewidth : 'rel' num 1
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ panel.spacing : 'simpleUnit' num 5.5points
..- attr(*, "unit")= int 8
$ panel.spacing.x : NULL
$ panel.spacing.y : NULL
$ panel.grid :List of 6
..$ colour : chr "grey87"
..$ linewidth : NULL
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.major :List of 6
..$ colour : NULL
..$ linewidth : 'rel' num 0.5
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.minor :List of 6
..$ colour : NULL
..$ linewidth : 'rel' num 0.25
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.major.x : NULL
$ panel.grid.major.y : NULL
$ panel.grid.minor.x : NULL
$ panel.grid.minor.y : NULL
$ panel.ontop : logi FALSE
$ plot.background :List of 5
..$ fill : NULL
..$ colour : chr "white"
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ plot.title :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 1.2
..$ hjust : num 0
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 5.5points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.title.position : chr "panel"
$ plot.subtitle :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 5.5points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.caption :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 0.8
..$ hjust : num 1
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 5.5points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.caption.position : chr "panel"
$ plot.tag :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 1.2
..$ hjust : num 0.5
..$ vjust : num 0.5
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.tag.position : chr "topleft"
$ plot.margin : 'margin' num [1:4] 5.5points 5.5points 5.5points 5.5points
..- attr(*, "unit")= int 8
$ strip.background : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ strip.background.x : NULL
$ strip.background.y : NULL
$ strip.clip : chr "inherit"
$ strip.placement : chr "inside"
$ strip.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : chr "white"
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 4.4points 4.4points 4.4points 4.4points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.x :List of 11
..$ family : NULL
..$ face : chr "bold"
..$ colour : chr "black"
..$ size : num 10
..$ hjust : num 0
..$ vjust : NULL
..$ angle : num 90
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.x.bottom : NULL
$ strip.text.x.top : NULL
$ strip.text.y :List of 11
..$ family : NULL
..$ face : chr "bold"
..$ colour : chr "black"
..$ size : num 10
..$ hjust : num 0
..$ vjust : NULL
..$ angle : num 0
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.y.left :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : NULL
..$ angle : num 90
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.y.right : NULL
$ strip.switch.pad.grid : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
$ strip.switch.pad.wrap : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
- attr(*, "class")= chr [1:2] "theme" "gg"
- attr(*, "complete")= logi TRUE
- attr(*, "validate")= logi TRUE
can plot correlation with groups
Code
p$data
Output
x y g
1 1 1 g1
2 2 2 g1
3 3 3 g1
4 4 4 g1
5 5 5 g2
6 6 6 g2
7 7 7 g2
8 8 8 g2
Code
p$gg
Output
$theme
List of 97
$ line :List of 6
..$ colour : chr "black"
..$ linewidth : num 0.5
..$ linetype : num 1
..$ lineend : chr "butt"
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ rect :List of 5
..$ fill : chr "white"
..$ colour : chr "black"
..$ linewidth : num 0.5
..$ linetype : num 1
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ text :List of 11
..$ family : chr ""
..$ face : chr "plain"
..$ colour : chr "black"
..$ size : num 11
..$ hjust : num 0.5
..$ vjust : num 0.5
..$ angle : num 0
..$ lineheight : num 0.9
..$ margin : 'margin' num [1:4] 0points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ title : NULL
$ aspect.ratio : NULL
$ axis.title : NULL
$ axis.title.x :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 2.75points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.x.top :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 2.75points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.x.bottom : NULL
$ axis.title.y :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 1
..$ angle : num 90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 2.75points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.y.left : NULL
$ axis.title.y.right :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : num -90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 0points 2.75points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : chr "grey30"
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 1
..$ vjust : num 0.5
..$ angle : num 90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 2.2points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x.top :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 2.2points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x.bottom : NULL
$ axis.text.y :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 1
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 2.2points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.y.left : NULL
$ axis.text.y.right :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 0points 2.2points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.ticks :List of 6
..$ colour : chr "grey70"
..$ linewidth : 'rel' num 0.5
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ axis.ticks.x : NULL
$ axis.ticks.x.top : NULL
$ axis.ticks.x.bottom : NULL
$ axis.ticks.y : NULL
$ axis.ticks.y.left : NULL
$ axis.ticks.y.right : NULL
$ axis.ticks.length : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
$ axis.ticks.length.x : NULL
$ axis.ticks.length.x.top : NULL
$ axis.ticks.length.x.bottom: NULL
$ axis.ticks.length.y : NULL
$ axis.ticks.length.y.left : NULL
$ axis.ticks.length.y.right : NULL
$ axis.line : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ axis.line.x : NULL
$ axis.line.x.top : NULL
$ axis.line.x.bottom : NULL
$ axis.line.y : NULL
$ axis.line.y.left : NULL
$ axis.line.y.right : NULL
$ legend.background :List of 5
..$ fill : NULL
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ legend.margin : 'margin' num [1:4] 5.5points 5.5points 5.5points 5.5points
..- attr(*, "unit")= int 8
$ legend.spacing : 'simpleUnit' num 11points
..- attr(*, "unit")= int 8
$ legend.spacing.x : NULL
$ legend.spacing.y : NULL
$ legend.key :List of 5
..$ fill : chr "white"
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ legend.key.size : 'simpleUnit' num 1.2lines
..- attr(*, "unit")= int 3
$ legend.key.height : NULL
$ legend.key.width : NULL
$ legend.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ legend.text.align : NULL
$ legend.title :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ legend.title.align : NULL
$ legend.position : chr "right"
$ legend.direction : NULL
$ legend.justification : chr "center"
$ legend.box : NULL
$ legend.box.just : NULL
$ legend.box.margin : 'margin' num [1:4] 0cm 0cm 0cm 0cm
..- attr(*, "unit")= int 1
$ legend.box.background : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ legend.box.spacing : 'simpleUnit' num 11points
..- attr(*, "unit")= int 8
$ panel.background :List of 5
..$ fill : chr "white"
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ panel.border :List of 5
..$ fill : logi NA
..$ colour : chr "grey70"
..$ linewidth : 'rel' num 1
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ panel.spacing : 'simpleUnit' num 5.5points
..- attr(*, "unit")= int 8
$ panel.spacing.x : NULL
$ panel.spacing.y : NULL
$ panel.grid :List of 6
..$ colour : chr "grey87"
..$ linewidth : NULL
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.major :List of 6
..$ colour : NULL
..$ linewidth : 'rel' num 0.5
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.minor :List of 6
..$ colour : NULL
..$ linewidth : 'rel' num 0.25
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.major.x : NULL
$ panel.grid.major.y : NULL
$ panel.grid.minor.x : NULL
$ panel.grid.minor.y : NULL
$ panel.ontop : logi FALSE
$ plot.background :List of 5
..$ fill : NULL
..$ colour : chr "white"
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ plot.title :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 1.2
..$ hjust : num 0
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 5.5points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.title.position : chr "panel"
$ plot.subtitle :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 5.5points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.caption :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 0.8
..$ hjust : num 1
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 5.5points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.caption.position : chr "panel"
$ plot.tag :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 1.2
..$ hjust : num 0.5
..$ vjust : num 0.5
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.tag.position : chr "topleft"
$ plot.margin : 'margin' num [1:4] 5.5points 5.5points 5.5points 5.5points
..- attr(*, "unit")= int 8
$ strip.background : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ strip.background.x : NULL
$ strip.background.y : NULL
$ strip.clip : chr "inherit"
$ strip.placement : chr "inside"
$ strip.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : chr "white"
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 4.4points 4.4points 4.4points 4.4points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.x :List of 11
..$ family : NULL
..$ face : chr "bold"
..$ colour : chr "black"
..$ size : num 10
..$ hjust : num 0
..$ vjust : NULL
..$ angle : num 90
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.x.bottom : NULL
$ strip.text.x.top : NULL
$ strip.text.y :List of 11
..$ family : NULL
..$ face : chr "bold"
..$ colour : chr "black"
..$ size : num 10
..$ hjust : num 0
..$ vjust : NULL
..$ angle : num 0
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.y.left :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : NULL
..$ angle : num 90
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.y.right : NULL
$ strip.switch.pad.grid : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
$ strip.switch.pad.wrap : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
- attr(*, "class")= chr [1:2] "theme" "gg"
- attr(*, "complete")= logi TRUE
- attr(*, "validate")= logi TRUE
cancerit/RCRISPR documentation built on April 26, 2023, 10:12 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
can plot correlation
Code
p$data
Output
sgRNA gene HELA_T0 HELA_T15A_CTRL HELA_T15B_CTRL
1 A1BG_CACCTTCGAGCTGCTGCGCG A1BG 478 519 439
2 A1BG_AAGAGCGCCTCGGTCCCAGC A1BG 0 0 0
3 A1BG_TGGACTTCCAGCTACGGCGC A1BG 274 193 163
HELA_T15C_CTRL HELA_T15A_OLA HELA_T15B_OLA HELA_T15C_OLA
1 587 389 591 274
2 52 0 16 0
3 161 80 393 45
Code
p$gg
Output
$theme
List of 97
$ line :List of 6
..$ colour : chr "black"
..$ linewidth : num 0.5
..$ linetype : num 1
..$ lineend : chr "butt"
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ rect :List of 5
..$ fill : chr "white"
..$ colour : chr "black"
..$ linewidth : num 0.5
..$ linetype : num 1
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ text :List of 11
..$ family : chr ""
..$ face : chr "plain"
..$ colour : chr "black"
..$ size : num 11
..$ hjust : num 0.5
..$ vjust : num 0.5
..$ angle : num 0
..$ lineheight : num 0.9
..$ margin : 'margin' num [1:4] 0points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ title : NULL
$ aspect.ratio : NULL
$ axis.title : NULL
$ axis.title.x :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 2.75points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.x.top :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 2.75points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.x.bottom : NULL
$ axis.title.y :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 1
..$ angle : num 90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 2.75points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.y.left : NULL
$ axis.title.y.right :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : num -90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 0points 2.75points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : chr "grey30"
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 1
..$ vjust : num 0.5
..$ angle : num 90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 2.2points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x.top :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 2.2points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x.bottom : NULL
$ axis.text.y :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 1
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 2.2points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.y.left : NULL
$ axis.text.y.right :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 0points 2.2points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.ticks :List of 6
..$ colour : chr "grey70"
..$ linewidth : 'rel' num 0.5
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ axis.ticks.x : NULL
$ axis.ticks.x.top : NULL
$ axis.ticks.x.bottom : NULL
$ axis.ticks.y : NULL
$ axis.ticks.y.left : NULL
$ axis.ticks.y.right : NULL
$ axis.ticks.length : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
$ axis.ticks.length.x : NULL
$ axis.ticks.length.x.top : NULL
$ axis.ticks.length.x.bottom: NULL
$ axis.ticks.length.y : NULL
$ axis.ticks.length.y.left : NULL
$ axis.ticks.length.y.right : NULL
$ axis.line : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ axis.line.x : NULL
$ axis.line.x.top : NULL
$ axis.line.x.bottom : NULL
$ axis.line.y : NULL
$ axis.line.y.left : NULL
$ axis.line.y.right : NULL
$ legend.background :List of 5
..$ fill : NULL
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ legend.margin : 'margin' num [1:4] 5.5points 5.5points 5.5points 5.5points
..- attr(*, "unit")= int 8
$ legend.spacing : 'simpleUnit' num 11points
..- attr(*, "unit")= int 8
$ legend.spacing.x : NULL
$ legend.spacing.y : NULL
$ legend.key :List of 5
..$ fill : chr "white"
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ legend.key.size : 'simpleUnit' num 1.2lines
..- attr(*, "unit")= int 3
$ legend.key.height : NULL
$ legend.key.width : NULL
$ legend.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ legend.text.align : NULL
$ legend.title :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ legend.title.align : NULL
$ legend.position : chr "right"
$ legend.direction : NULL
$ legend.justification : chr "center"
$ legend.box : NULL
$ legend.box.just : NULL
$ legend.box.margin : 'margin' num [1:4] 0cm 0cm 0cm 0cm
..- attr(*, "unit")= int 1
$ legend.box.background : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ legend.box.spacing : 'simpleUnit' num 11points
..- attr(*, "unit")= int 8
$ panel.background :List of 5
..$ fill : chr "white"
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ panel.border :List of 5
..$ fill : logi NA
..$ colour : chr "grey70"
..$ linewidth : 'rel' num 1
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ panel.spacing : 'simpleUnit' num 5.5points
..- attr(*, "unit")= int 8
$ panel.spacing.x : NULL
$ panel.spacing.y : NULL
$ panel.grid :List of 6
..$ colour : chr "grey87"
..$ linewidth : NULL
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.major :List of 6
..$ colour : NULL
..$ linewidth : 'rel' num 0.5
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.minor :List of 6
..$ colour : NULL
..$ linewidth : 'rel' num 0.25
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.major.x : NULL
$ panel.grid.major.y : NULL
$ panel.grid.minor.x : NULL
$ panel.grid.minor.y : NULL
$ panel.ontop : logi FALSE
$ plot.background :List of 5
..$ fill : NULL
..$ colour : chr "white"
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ plot.title :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 1.2
..$ hjust : num 0
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 5.5points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.title.position : chr "panel"
$ plot.subtitle :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 5.5points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.caption :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 0.8
..$ hjust : num 1
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 5.5points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.caption.position : chr "panel"
$ plot.tag :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 1.2
..$ hjust : num 0.5
..$ vjust : num 0.5
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.tag.position : chr "topleft"
$ plot.margin : 'margin' num [1:4] 5.5points 5.5points 5.5points 5.5points
..- attr(*, "unit")= int 8
$ strip.background : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ strip.background.x : NULL
$ strip.background.y : NULL
$ strip.clip : chr "inherit"
$ strip.placement : chr "inside"
$ strip.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : chr "white"
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 4.4points 4.4points 4.4points 4.4points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.x :List of 11
..$ family : NULL
..$ face : chr "bold"
..$ colour : chr "black"
..$ size : num 10
..$ hjust : num 0
..$ vjust : NULL
..$ angle : num 90
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.x.bottom : NULL
$ strip.text.x.top : NULL
$ strip.text.y :List of 11
..$ family : NULL
..$ face : chr "bold"
..$ colour : chr "black"
..$ size : num 10
..$ hjust : num 0
..$ vjust : NULL
..$ angle : num 0
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.y.left :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : NULL
..$ angle : num 90
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.y.right : NULL
$ strip.switch.pad.grid : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
$ strip.switch.pad.wrap : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
- attr(*, "class")= chr [1:2] "theme" "gg"
- attr(*, "complete")= logi TRUE
- attr(*, "validate")= logi TRUE
can plot correlation with groups
Code
p$data
Output
x y g
1 1 1 g1
2 2 2 g1
3 3 3 g1
4 4 4 g1
5 5 5 g2
6 6 6 g2
7 7 7 g2
8 8 8 g2
Code
p$gg
Output
$theme
List of 97
$ line :List of 6
..$ colour : chr "black"
..$ linewidth : num 0.5
..$ linetype : num 1
..$ lineend : chr "butt"
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ rect :List of 5
..$ fill : chr "white"
..$ colour : chr "black"
..$ linewidth : num 0.5
..$ linetype : num 1
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ text :List of 11
..$ family : chr ""
..$ face : chr "plain"
..$ colour : chr "black"
..$ size : num 11
..$ hjust : num 0.5
..$ vjust : num 0.5
..$ angle : num 0
..$ lineheight : num 0.9
..$ margin : 'margin' num [1:4] 0points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ title : NULL
$ aspect.ratio : NULL
$ axis.title : NULL
$ axis.title.x :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 2.75points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.x.top :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 2.75points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.x.bottom : NULL
$ axis.title.y :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 1
..$ angle : num 90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 2.75points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.title.y.left : NULL
$ axis.title.y.right :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : num -90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 0points 2.75points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : chr "grey30"
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 1
..$ vjust : num 0.5
..$ angle : num 90
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 2.2points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x.top :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : num 0
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 2.2points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.x.bottom : NULL
$ axis.text.y :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 1
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 2.2points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.text.y.left : NULL
$ axis.text.y.right :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 0points 2.2points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ axis.ticks :List of 6
..$ colour : chr "grey70"
..$ linewidth : 'rel' num 0.5
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ axis.ticks.x : NULL
$ axis.ticks.x.top : NULL
$ axis.ticks.x.bottom : NULL
$ axis.ticks.y : NULL
$ axis.ticks.y.left : NULL
$ axis.ticks.y.right : NULL
$ axis.ticks.length : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
$ axis.ticks.length.x : NULL
$ axis.ticks.length.x.top : NULL
$ axis.ticks.length.x.bottom: NULL
$ axis.ticks.length.y : NULL
$ axis.ticks.length.y.left : NULL
$ axis.ticks.length.y.right : NULL
$ axis.line : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ axis.line.x : NULL
$ axis.line.x.top : NULL
$ axis.line.x.bottom : NULL
$ axis.line.y : NULL
$ axis.line.y.left : NULL
$ axis.line.y.right : NULL
$ legend.background :List of 5
..$ fill : NULL
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ legend.margin : 'margin' num [1:4] 5.5points 5.5points 5.5points 5.5points
..- attr(*, "unit")= int 8
$ legend.spacing : 'simpleUnit' num 11points
..- attr(*, "unit")= int 8
$ legend.spacing.x : NULL
$ legend.spacing.y : NULL
$ legend.key :List of 5
..$ fill : chr "white"
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ legend.key.size : 'simpleUnit' num 1.2lines
..- attr(*, "unit")= int 3
$ legend.key.height : NULL
$ legend.key.width : NULL
$ legend.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ legend.text.align : NULL
$ legend.title :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ legend.title.align : NULL
$ legend.position : chr "right"
$ legend.direction : NULL
$ legend.justification : chr "center"
$ legend.box : NULL
$ legend.box.just : NULL
$ legend.box.margin : 'margin' num [1:4] 0cm 0cm 0cm 0cm
..- attr(*, "unit")= int 1
$ legend.box.background : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ legend.box.spacing : 'simpleUnit' num 11points
..- attr(*, "unit")= int 8
$ panel.background :List of 5
..$ fill : chr "white"
..$ colour : logi NA
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ panel.border :List of 5
..$ fill : logi NA
..$ colour : chr "grey70"
..$ linewidth : 'rel' num 1
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ panel.spacing : 'simpleUnit' num 5.5points
..- attr(*, "unit")= int 8
$ panel.spacing.x : NULL
$ panel.spacing.y : NULL
$ panel.grid :List of 6
..$ colour : chr "grey87"
..$ linewidth : NULL
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.major :List of 6
..$ colour : NULL
..$ linewidth : 'rel' num 0.5
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.minor :List of 6
..$ colour : NULL
..$ linewidth : 'rel' num 0.25
..$ linetype : NULL
..$ lineend : NULL
..$ arrow : logi FALSE
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_line" "element"
$ panel.grid.major.x : NULL
$ panel.grid.major.y : NULL
$ panel.grid.minor.x : NULL
$ panel.grid.minor.y : NULL
$ panel.ontop : logi FALSE
$ plot.background :List of 5
..$ fill : NULL
..$ colour : chr "white"
..$ linewidth : NULL
..$ linetype : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_rect" "element"
$ plot.title :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 1.2
..$ hjust : num 0
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 5.5points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.title.position : chr "panel"
$ plot.subtitle :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : num 0
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 0points 0points 5.5points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.caption :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 0.8
..$ hjust : num 1
..$ vjust : num 1
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 5.5points 0points 0points 0points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.caption.position : chr "panel"
$ plot.tag :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : 'rel' num 1.2
..$ hjust : num 0.5
..$ vjust : num 0.5
..$ angle : NULL
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ plot.tag.position : chr "topleft"
$ plot.margin : 'margin' num [1:4] 5.5points 5.5points 5.5points 5.5points
..- attr(*, "unit")= int 8
$ strip.background : list()
..- attr(*, "class")= chr [1:2] "element_blank" "element"
$ strip.background.x : NULL
$ strip.background.y : NULL
$ strip.clip : chr "inherit"
$ strip.placement : chr "inside"
$ strip.text :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : chr "white"
..$ size : 'rel' num 0.8
..$ hjust : NULL
..$ vjust : NULL
..$ angle : NULL
..$ lineheight : NULL
..$ margin : 'margin' num [1:4] 4.4points 4.4points 4.4points 4.4points
.. ..- attr(*, "unit")= int 8
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.x :List of 11
..$ family : NULL
..$ face : chr "bold"
..$ colour : chr "black"
..$ size : num 10
..$ hjust : num 0
..$ vjust : NULL
..$ angle : num 90
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.x.bottom : NULL
$ strip.text.x.top : NULL
$ strip.text.y :List of 11
..$ family : NULL
..$ face : chr "bold"
..$ colour : chr "black"
..$ size : num 10
..$ hjust : num 0
..$ vjust : NULL
..$ angle : num 0
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi FALSE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.y.left :List of 11
..$ family : NULL
..$ face : NULL
..$ colour : NULL
..$ size : NULL
..$ hjust : NULL
..$ vjust : NULL
..$ angle : num 90
..$ lineheight : NULL
..$ margin : NULL
..$ debug : NULL
..$ inherit.blank: logi TRUE
..- attr(*, "class")= chr [1:2] "element_text" "element"
$ strip.text.y.right : NULL
$ strip.switch.pad.grid : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
$ strip.switch.pad.wrap : 'simpleUnit' num 2.75points
..- attr(*, "unit")= int 8
- attr(*, "class")= chr [1:2] "theme" "gg"
- attr(*, "complete")= logi TRUE
- attr(*, "validate")= logi TRUE
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.