knitr::opts_chunk$set( collapse = TRUE, comment = "#>", fig.path = "choosing-assays-figs/" )
Here are some explorations that we are doing for selecting SNPs that we can turn into assays.
I think that I will do most of the operations using using information in the 012 file. Then at the end we can pull the sequences out that we need and go from there to compile the assay order.
One issue we have come up against is the question of how aggressive we want to be about ensuring that we don't variation in the flanking sequences. We have been working with data sets that have been filtered to only include SNPs that have been typed in lots of individuals. This might leave out some SNPs on the edges of the paired-ends. We might want to go back and get that variation. At first, we had chosen not to go back and get it, since we were quite successful designing SNPs from a fairly small number of individuals (about 20) in WIWAs. But then I recalled that we let FLORAGANEX designate which SNPs were assayable, and they might have been using all the variation.
What is clear, however, is that we will want to filter out rare variation before assessing whether something is assayable. There is no point in worrying about the influence of rare variants on SNP assayability. And further, we are not going to be interested in designing assays for rare variants, so we really can just toss them out from the beginning.
Nonetheless, it will be interesting to see how many assayable SNPs we are left with while using different criteria. So, I will write a quick and dirty function for that.
Load some libraries:
library(dplyr) library(ggplot2) library(GGally) library(genoscapeRtools) library(readr) library(stringr)
Then read in data from the original 012 file (with 350K SNPs):
wifl <- read_012(prefix = "~/Documents/UnsyncedData/WIFL_10-15-16/wifl-10-15-16", gz = TRUE)
Now, we want a function that will:
Let's make that:
#' return SNPs and say whether the are assayable or not, along with the MAFs #' @param w a matrix like produced by read_012 #' @param MAF the minimum minor allele frequency to retain a SNP either for assaying #' or for determining whether there is flanking variation. compile_assayable <- function(w, minMAF = 0.03, flank = 20) { w[w == -1] <- NA # mark the missing ones as missing. gc <- (2 * colSums(!is.na(w))) # count how many gene copies are copied at each SNP frq <- colSums(w, na.rm = TRUE) / gc # get the overall freqs of the "1" allele keepers <- frq > minMAF & frq < 1.0 - minMAF # now make a data frame of them and keep track of the scaffold and base pairs too: df <- dplyr::data_frame(snp = colnames(w)[keepers], num_gene_copies = gc[keepers], freq = frq[keepers]) %>% dplyr::mutate(pos = snp) %>% tidyr::separate(pos, into = c("scaffold", "bp"), sep = "--", convert = TRUE) %>% dplyr::mutate(length = as.numeric(str_replace(scaffold, "scaff.*size", ""))) %>% dplyr::group_by(scaffold) %>% dplyr::mutate(leftpos = c(0,bp)[-(n() + 1)], rightpos = c(bp, length[1])[-1]) %>% dplyr::mutate(leftpad = bp - leftpos, rightpad = rightpos - bp) %>% dplyr::ungroup() # and in the end, we will specify the status of each: df %>% dplyr::mutate(assayable = ifelse(rightpad > 20 & leftpad > 20, TRUE, FALSE)) %>% dplyr::mutate(on_right_edge = ifelse(rightpad > 2000, TRUE, FALSE), on_left_edge = ifelse(leftpad > 2000, TRUE, FALSE) ) }
And with that we can pretty quickly count up the results of doing different types of filtering:
ca <- compile_assayable(wifl) # and once we have done that, we can just tally things up: ca %>% group_by(assayable, on_right_edge, on_left_edge) %>% tally()
The "almost certainly assayable" group there is "TRUE, FALSE, FALSE". There are a lot of those. We probably would want to follow up on all the assayable=TRUE categories. The TRUE, TRUE, TRUEs might be in regions of low diversity (maybe under selection), so we should follow up with them.
Now, we can see how different the results would have been if we chose 0.01 as our MAF cutoff instead of 0.03. We do that by identifying assayable ones, then pitching any out that have MAFs below 0.03 (so that we are still retaining only assayable SNPs with freqs greater than 0.03).
ca01 <- compile_assayable(wifl, minMAF = 0.01) ca01 %>% filter(freq > 0.03 & freq < 0.97) %>% group_by(assayable, on_right_edge, on_left_edge) %>% tally()
So that is fewer than before. Not a whole lot fewer, but still fairly substantial. I think it would be good to filter at about 0.03, myself.
This will vary by species. Gonna do this later.
From the foregoing, it is clear we can identify assayable SNPs. Then we will choose which ones we want. Once we have them in hand we will need to make assays from them. This is different than it was before because we don't have things in tidy little RAD loci. We have to go back to the genome to pull out the sequences. Hmmm...I think we can use samtools and and indexed fasta file to do that.
Let's experiment. ```{sh, eval=FALSE}
2016-12-02 05:54 /WIFL_genome/--% pwd /Users/eriq/Documents/UnsyncedData/WIFL_genome 2016-12-02 05:54 /WIFL_genome/--% samtools faidx WIFL.fa
2016-12-02 06:01 /WIFL_genome/--% samtools faidx WIFL.fa "scaffold1|size7828297:92000-92060" "scaffold1|size7828297:388919-389000"
scaffold1|size7828297:92000-92060 CCGGTTTTTTTTCCCCCCGGCCCTAAATCCGCTCAGTTCGGGGCATTCCCTCCCGCTTTC T scaffold1|size7828297:388919-389000 GCATTTCACACAGCACGGTCCATTTGGTGGCTGGGGCTTTGCTTGAAGCAGGTCATGGGG AAGAATCCAGCTCCTTCCTTCA
Kabam! That is super fast and beautiful! So, let's pretend that I have the 100 SNPs I want to get. For fun, i will just grab these at random ```r bogus100 <- ca %>% filter(assayable == TRUE, on_right_edge == FALSE, on_left_edge == FALSE) %>% sample_n(100)
And now we can extract the sequences around each of those, with 50 bp on either side, let's say
regions <- paste("\"", bogus100$scaffold, ":", bogus100$bp - 50, "-", bogus100$bp + 50, "\"", sep = "") region_string <- paste(regions, collapse = " ") fasta <- "~/Documents/UnsyncedData/WIFL_genome/WIFL.fa" call <- paste("samtools faidx ", fasta, region_string) system(call)
Now I just need to munge those sequences together into single strings and put them in a data frame and I will be able to use "snps2assays" to make the assay orders.
Cool.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.