create_kmer_origin_list: Create _k_-mer lists with their original sequences

In kkrismer/transite: RNA-binding protein motif analysis

Create k-mer lists with their original sequences

Description

Counts occurrences of k-mers of length k in the given set of sequences. A list of the sequences the k-mer originated from is created and returned. If the k-mer does not exist in any of the sequences, the list is empty for that k-mer.

Usage

create_kmer_origin_list(sequences, k)

Arguments

sequences	character vector of DNA or RNA sequences that constitute the whole set of sequences being analyzed
k	number of characters in k-mer

Value

A list with k-mers as the identifier and a vector of sequences for each k-mer that the k-mer is found in

See Also

Other k-mer functions: calculate_kmer_enrichment(), check_kmers(), compute_kmer_enrichment(), count_homopolymer_corrected_kmers(), draw_volcano_plot(), estimate_significance(), estimate_significance_core(), generate_kmers(), generate_permuted_enrichments(), run_kmer_spma(), run_kmer_tsma()

Examples

# define simple sequence sets for foreground and background
sequence_set <- c(
  "CAACAGCCUUAAUU", "CAGUCAAGACUCC", "CUUUGGGGAAU",
  "UCAUUUUAUUAAA", "AAUUGGUGUCUGGAUACUUCCCUGUACAU",
  "AUCAAAUUA", "AGAU", "GACACUUAAAGAUCCU",
  "UAGCAUUAACUUAAUG", "AUGGA", "GAAGAGUGCUCA",
  "AUAGAC", "AGUUC", "CCAGUAA"
)
kmer_origin_list <- create_kmer_origin_list(sequence_set, k = 6)

kkrismer/transite documentation built on July 13, 2024, 8:01 a.m.