| readHMC | R Documentation |
This function reads the “HapMap.hmc.txt” and “HapMap.fas.txt” files output by the UNEAK pipeline and uses the data to generate a “RADdata” object.
readHMC(file, includeLoci = NULL, shortIndNames = TRUE,
possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001,
fastafile = sub("hmc.txt", "fas.txt", file, fixed = TRUE))
file |
Name of the file containing read depth (typically “HapMap.hmc.txt”). |
includeLoci |
An optional character vector of loci to be included in the output. |
shortIndNames |
Boolean. If TRUE, taxa names will be shortened with respect to those in the file, eliminating all text after and including the first underscore. |
possiblePloidies |
A list of numeric vectors indicating potential inheritance modes of SNPs in the
dataset. See |
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
A number ranging from zero to one (typically small) indicating the expected rate of sample cross-contamination. |
fastafile |
Name of the file containing tag sequences (typically “HapMap.fas.txt”). |
A RADdata object containing read depth, taxa and locus names, and
nucleotides at variable sites.
UNEAK is not able to report read depths greater than 127, which may be problematic for high depth data on polyploid organisms. The UNEAK pipeline is no longer being updated and is currently only available with archived versions of TASSEL.
Lindsay V. Clark
Lu, F., Lipka, A. E., Glaubitz, J., Elshire, R., Cherney, J. H., Casler, M. D., Buckler, E. S. and Costich, D. E. (2013) Switchgrass genomic diversity, ploidy, and evolution: novel insights from a network-based SNP discovery protocol. PLoS Genetics 9, e1003215.
https://www.maizegenetics.net/tassel
https://tassel.bitbucket.io/TasselArchived.html
readTagDigger, VCF2RADdata,
readStacks, readTASSELGBSv2,
readDArTag
# for this example we'll create dummy files rather than using real ones
hmc <- tempfile()
write.table(data.frame(rs = c("TP1", "TP2", "TP3"),
ind1_merged_X3 = c("15|0", "4|6", "13|0"),
ind2_merged_X3 = c("0|0", "0|1", "0|5"),
HetCount_allele1 = c(0, 1, 0),
HetCount_allele2 = c(0, 1, 0),
Count_allele1 = c(15, 4, 13),
Count_allele2 = c(0, 7, 5),
Frequency = c(0, 0.75, 0.5)), row.names = FALSE,
quote = FALSE, col.names = TRUE, sep = "\t", file = hmc)
fas <- tempfile()
writeLines(c(">TP1_query_64",
"TGCAGAAAAAAAACGCTCGATGCCCCCTAATCCGTTTTCCCCATTCCGCTCGCCCCATCGGAGT",
">TP1_hit_64",
"TGCAGAAAAAAAACGCTCGATGCCCCCTAATCCGTTTTCCCCATTCCGCTCGCCCCATTGGAGT",
">TP2_query_64",
"TGCAGAAAAACAACACCCTAGGTAACAACCATATCTTATATTGCCGAATAAAAAACAACACCCC",
">TP2_hit_64",
"TGCAGAAAAACAACACCCTAGGTAACAACCATATCTTATATTGCCGAATAAAAAATAACACCCC",
">TP3_query_64",
"TGCAGAAAACATGGAGAGGGAGATGGCACGGCAGCACCACCGCTGGTCCGCTGCCCGTTTGCGG",
">TP3_hit_64",
"TGCAGAAAACATGGAGATGGAGATGGCACGGCAGCACCACCGCTGGTCCGCTGCCCGTTTGCGG"),
fas)
# now read the data
mydata <- readHMC(hmc, fastafile = fas)
# inspect the results
mydata
mydata$alleleDepth
mydata$alleleNucleotides
row.names(mydata$locTable)
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.