doRCtest: Test if pattern aligns better in +/- orientation.

In malnirav/hiReadsProcessor: Functions to process LM-PCR reads from 454/Illumina data

Description

Given a fixed length pattern sequence and variable length subject sequences, the function roughly finds which orientation of pattern yields the most hits. The function doing the heavylifting is vcountPattern. This is an accessory function used in function listed under See Also section below.

Usage

doRCtest(
  subjectSeqs = NULL,
  patternSeq = NULL,
  qualityThreshold = 0.5,
  parallel = TRUE
)

Arguments

subjectSeqs	DNAStringSet object containing sequences to be searched for the pattern.
patternSeq	DNAString object or a sequence containing the query sequence to search.
qualityThreshold	percent of patternSeq to match. Default is 0.50, half match. This is supplied to max.mismatch parameter of vcountPattern as round(nchar(patternSeq)*(1-qualityThreshold)).
parallel	use parallel backend to perform calculation with BiocParallel. Defaults to FALSE. If no parallel backend is registered, then a serial version is ran using SerialParam.

Value

patternSeq that aligned the best.

See Also

pairwiseAlignSeqs, vpairwiseAlignSeqs, primerIDAlignSeqs

Examples

subjectSeqs <- c("CCTGAATCCTGGCAATGTCATCATC", "ATCCTGGCAATGTCATCATCAATGG", 
"ATCAGTTGTCAACGGCTAATACGCG", "ATCAATGGCGATTGCCGCGTCTGCA", 
"CCGCGTCTGCAATGTGAGGGCCTAA", "GAAGGATGCCAGTTGAAGTTCACAC")
subjectSeqs <- xscat("AAAAAAAAAA", subjectSeqs)
doRCtest(subjectSeqs, "TTTTTTTTT")

malnirav/hiReadsProcessor documentation built on July 29, 2021, 6:33 a.m.