replicateReads: Replicate sequences from DNAStringSet object using counts...

Description Usage Arguments Value See Also Examples

View source: R/hiReadsProcessor.R

Description

Given a DNAStringSet object, the function replicates reads using counts=X marker at the end of definition line.

Usage

1
replicateReads(dnaSet, counts = NULL)

Arguments

dnaSet

DNAStringSet object to replicate.

counts

an integer or a numeric vector of length length(dnaSet) indicating how many times to repeat each sequence. Default is NULL, in which it uses counts=X notation from the definition line to replicate reads.

Value

DNAStringSet object.

See Also

dereplicateReads, removeReadsWithNs, findBarcodes, splitByBarcode

Examples

1
2
3
4
5
6
7
8
9
 
dnaSet <- c("CCTGAATCCTGGCAATGTCATCATC", "ATCCTGGCAATGTCATCATCAATGG", 
"ATCAGTTGTCAACGGCTAATACGCG", "ATCAATGGCGATTGCCGCGTCTGCA", 
"CCGCGTCTGCAATGTGAGGGCCTAA", "GAAGGATGCCAGTTGAAGTTCACAC", 
"CCTGAATCCTGGCAATGTCATCATC", "ATCCTGGCAATGTCATCATCAATGG", 
"ATCAGTTGTCAACGGCTAATACGCG", "ATCAATGGCGATTGCCGCGTCTGCA", 
"CCGCGTCTGCAATGTGAGGGCCTAA", "GAAGGATGCCAGTTGAAGTTCACAC") 
dnaSet <- dereplicateReads(dnaSet)
replicateReads(dnaSet)

malnirav/hiReadsProcessor documentation built on Sept. 17, 2017, 10:56 a.m.