vpairwiseAlignSeqs: Align a short pattern to variable length target sequences.

In malnirav/hiReadsProcessor: Functions to process LM-PCR reads from 454/Illumina data

Description

Align a fixed length short pattern sequence to subject sequences using vmatchPattern. This function is meant for aligning a short pattern onto large collection of subjects. If you are looking to align a vector sequence to subjects, then please use BLAT.

Usage

vpairwiseAlignSeqs(
  subjectSeqs = NULL,
  patternSeq = NULL,
  side = "left",
  qualityThreshold = 1,
  showStats = FALSE,
  bufferBases = 5,
  doRC = TRUE,
  parallel = FALSE,
  ...
)

Arguments

subjectSeqs	DNAStringSet object containing sequences to be searched for the pattern. This is generally bigger than patternSeq, and cases where subjectSeqs is smaller than patternSeq will be ignored in the alignment.
patternSeq	DNAString object or a sequence containing the query sequence to search. This is generally smaller than subjectSeqs.
side	which side of the sequence to perform the search: left, right, or middle. Default is 'left'.
qualityThreshold	percent of patternSeq to match. Default is 1, full match. This is supplied to max.mismatch parameter of vmatchPattern as round(nchar(patternSeq)*(1-qualityThreshold)).
showStats	toggle output of search statistics. Default is FALSE.
bufferBases	use x number of bases in addition to patternSeq length to perform the search. Beneficial in cases where the pattern has homopolymers or indels compared to the subject. Default is 5. Doesn't apply when side='middle'.
doRC	perform reverse complement search of the defined pattern. Default is TRUE.
parallel	use parallel backend to perform calculation with BiocParallel. Defaults to FALSE. If no parallel backend is registered, then a serial version is ran using SerialParam.
...	extra parameters for vmatchPattern except for 'max.mismatch' since it's calculated internally using the 'qualityThreshold' parameter.

Value

IRanges object with starts, stops, and names of the aligned sequences.

Note

• For qualityThreshold, the alignment score is calculated by (matches*2)-(mismatches+gaps) which programatically translates to round(nchar(patternSeq)*qualityThreshold)*2.

• No indels are allowed in the function, if expecting indels then use pairwiseAlignSeqs.

• If qualityThreshold is 1, then it is a full match, if 0, then any match is accepted which is useful in searching linker sequences at 3' end. Beware, this function only searches for the pattern sequence in one orientation. If you are expecting to find the pattern in both orientation, you might be better off using BLAST/BLAT!

• If parallel=TRUE, then be sure to have a parallel backend registered before running the function. One can use any of the following MulticoreParam SnowParam

See Also

pairwiseAlignSeqs, primerIDAlignSeqs, doRCtest, findAndTrimSeq, blatSeqs, findAndRemoveVector

Examples

subjectSeqs <- c("CCTGAATCCTGGCAATGTCATCATC", "ATCCTGGCAATGTCATCATCAATGG", 
"ATCAGTTGTCAACGGCTAATACGCG", "ATCAATGGCGATTGCCGCGTCTGCA", 
"CCGCGTCTGCAATGTGAGGGCCTAA", "GAAGGATGCCAGTTGAAGTTCACAC")
subjectSeqs <- DNAStringSet(xscat("AAAAAAAAAA", subjectSeqs))
vpairwiseAlignSeqs(subjectSeqs, "AAAAAAAAAA", showStats=TRUE)
vpairwiseAlignSeqs(subjectSeqs, "AAAAAAAAAA", showStats=TRUE,
qualityThreshold=0.5)

malnirav/hiReadsProcessor documentation built on July 29, 2021, 6:33 a.m.