whales: Cetacean 16S rDNA sequences.

Description Usage Format Source References

Description

A dataset containing 19 mitochondrial 16S rDNA sequences from 18 cetacean species, downloaded from GenBank on 27 March 2018.

Usage

1

Format

A "DNAbin" list object containing 19 cetacean mitochondrial sequences in raw-byte format, averaging 130 nucleotides in length. The sequences are named with the GenBank accession numbers followed by a "|" symbol, followed by their NCBI taxonomy ID numbers. The sequences were downloaded using the searchGB function on 17 June 2018 (query term: "cetacea[ORGN]+AND+16S+rRNA[GENE]"), and trimmed using the virtualPCR function with the primers 16Smam1 and 16Smam2 (CGGTTGGGGTGACCTCGGA and GCTGTTATCCCTAGGGTAACT, respectively; Taylor 1996).

Source

https://www.ncbi.nlm.nih.gov/genbank/

References

Taylor PG (1996) Reproducibility of ancient DNA sequences from extinct Pleistocene fauna. Molecular Biology and Evolution, 13, 283-285.


shaunpwilkinson/insect documentation built on Nov. 13, 2018, 4:28 p.m.