virtualPCR: Virtual PCR.
In shaunpwilkinson/insect: Informatic Sequence Classification Trees

Description Usage Arguments Value Author(s) Examples

virtualPCR queries a list of DNA sequences with virtual primers (either sequences or profile hidden Markov models) and returns only the sequences that contain regions of sufficient similarity based on log-odds alignment scoring.

virtualPCR(
  x,
  up,
  down = NULL,
  rcdown = TRUE,
  trimprimers = FALSE,
  minfsc = 50,
  minrsc = 50,
  minamplen = 50,
  maxamplen = 2000,
  maxNs = 0.02,
  partialbind = TRUE,
  cores = 1,
  quiet = FALSE
)

`x`	a list of DNA sequences in `DNAbin` format.
`up`	an object of class `DNAbin` or `PHMM` giving the forward primer with which to query the sequence list.
`down`	an optional argument the same type as `up` giving the reverse primer with which to query the sequence list. If NULL only the forward primer is used.
`rcdown`	logical indicating whether the reverse primer should be reverse-complemented prior to aligning with the input sequences. Set to TRUE only if `down` is not NULL, is of class `DNAbin`, and is the reverse complement of the target sequence (e.g. the sequence of a reverse primer as would be ordered from an oligo supplier).
`trimprimers`	logical indicating whether the primer-binding sites should be removed from the sequences in the returned list.
`minfsc`	numeric, giving the minimum specificity(log-odds score for the optimal alignment) between the forward primer and a sequence for that sequence to be retained.
`minrsc`	numeric, the minimum specificity (log-odds score for the optimal alignment) between the reverse primer (if provided) and a sequence for that sequence to be retained.
`minamplen, maxamplen`	integers giving the minimum and maximum acceptable amplicon lengths. Sequences are discarded if the number of base pairs between the primer-binding sites falls outside of these limits.
`maxNs`	numeric giving the maximum acceptable proportion of the ambiguous residue "N" within the output sequences. Defaults to 0.02.
`partialbind`	logical indicating whether partial primer matching is accepted. Defaults to TRUE.
`cores`	integer giving the number of processors for multithreading. Defaults to 1, and reverts to 1 if x is not a list. This argument may alternatively be a 'cluster' object, in which case it is the user's responsibility to close the socket connection at the conclusion of the operation, for example by running `parallel::stopCluster(cores)`. The string 'autodetect' is also accepted, in which case the maximum number of cores to use is one less than the total number of cores available. Note that in this case there may be a tradeoff in terms of speed depending on the number and size of sequences to be processed, due to the extra time required to initialize the cluster.
`quiet`	logical indicating whether progress should be printed to the console.

a list of trimmed sequences, an object of class DNAbin.

Shaun Wilkinson

  ## trim whale sequences using a new set of inner primers
  inner_for <- "CGGTTGGGGTGACCTCGGAGTA"
  inner_rev <- "GCTGTTATCCCTAGGGTAA"
  whales_short <- virtualPCR(whales, up = inner_for, down = inner_rev,
                             trimprimers = TRUE)