gb2fasta: Conversion of GenBank file into fasta file

Description Usage Arguments Details Value Author(s) References See Also Examples

View source: R/gb2fasta.R


Converts a single entry in GenBank format into a fasta file.


gb2fasta(source.file, destination.file)



GenBank file


Fasta file


Multiple entries in GenBank file are not supported.




J.R. Lobry



See Also



  myGenBankFile <- system.file("sequences/ct.gbk.gz", package = "seqinr")
  myFastaFileName <- "Acinetobacter_ADP1_uid61597.fasta"
  gb2fasta(myGenBankFile, myFastaFileName)
  # Should be :
  # [1] ">CHLTCG 1042519 bp"                                          
  # [2] "gcggccgcccgggaaattgctaaaagatgggagcaaagagttagagatctacaagataaa"
  # [3] "ggtgctgcacgaaaattattaaatgatcctttaggccgacgaacacctaattatcagagc"
  # [4] "aaaaatccaggtgagtatactgtagggaattccatgttttacgatggtcctcaggtagcg"
  # [5] "aatctccagaacgtcgacactggtttttggctggacatgagcaatctctcagacgttgta"

seqinr documentation built on May 31, 2017, 2:20 a.m.

Search within the seqinr package
Search all R packages, documentation and source code