
context("Text access of attributes from CrisprSet objects")


test_that("consensusSeqs returns the correct sequence", {
    expected <- Biostrings::DNAString("GTCTTGGTCTCTCGCAGGATGCTGGAGCCA")
    alleles <- consensusSeqs(gol)
    expect_true(alleles[["-3:3D"]] == expected)
    expect_true(identical(rownames(gol$cigar_freqs), names(alleles)))

Try the CrispRVariants package in your browser

Any scripts or data that you put into this service are public.

CrispRVariants documentation built on Jan. 5, 2019, 6:54 p.m.