Diverge: Generate a set of diverging haplotypes

In QSutils: Quasispecies Diversity

Description

Generates a set of diverging haplotypes from the given DNA sequence. The haplotypes produced share a pattern of divergence with an increasing number of mutations.

Usage

Diverge(vm, seq)

Arguments

vm	Vector with number of diverging mutations to be generated.
seq	Reference sequence from which to generate the variants.

Details

max(vm) Positions in the given sequence are randomly generated. A substitution is also randomly produced for each of these positions. A haplotype is generated for each element in vm, so that it contains vm[i] substitutions of those previously generated.

Value

Character string vector with the segregating haplotypes generated.

Author(s)

Mercedes Guerrero-Murillo and Josep Gregori

See Also

GetRandomSeq

Examples

set.seed(123)
m1 <- GetRandomSeq(50)
hpl <- Diverge(3:6,m1)
DottedAlignment(DNAStringSet(hpl))

Example output

Loading required package: Biostrings
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: ‘BiocGenerics’

The following objects are masked from ‘package:parallel’:

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from ‘package:stats’:

    IQR, mad, sd, var, xtabs

The following objects are masked from ‘package:base’:

    anyDuplicated, append, as.data.frame, basename, cbind, colnames,
    dirname, do.call, duplicated, eval, evalq, Filter, Find, get, grep,
    grepl, intersect, is.unsorted, lapply, Map, mapply, match, mget,
    order, paste, pmax, pmax.int, pmin, pmin.int, Position, rank,
    rbind, Reduce, rownames, sapply, setdiff, sort, table, tapply,
    union, unique, unsplit, which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: ‘S4Vectors’

The following object is masked from ‘package:base’:

    expand.grid

Loading required package: IRanges
Loading required package: XVector

Attaching package: ‘Biostrings’

The following object is masked from ‘package:base’:

    strsplit

[1] "GGGCGCGCGATCCACGTAGGATAAAGGCGCAAGTCAGGATGTCAGAACGG"
[2] ".....................................A............"
[3] "........................C............A............"
[4] "........................C........C...A............"

QSutils documentation built on Nov. 8, 2020, 7:42 p.m.