TAPseqInput: Create TAPseq input from target sequences
In TAPseq: Targeted scRNA-seq primer design for TAP-seq

Description Usage Arguments Value Examples

This function creates input for TAP-seq primer design from a DNAStringSet containing the target sequences (typically transcript sequences).

TAPseqInput(
  target_sequences,
  product_size_range,
  beads_oligo = NA,
  reverse_primer = "CTACACGACGCTCTTCCGATCT",
  target_annot = NULL,
  primer_num_return = 5,
  min_primer_region = 100,
  primer_opt_tm = 63,
  primer_min_tm = 59,
  primer_max_tm = 66
)

`target_sequences`	A named `DNAStringSet` object containing all target sequences.
`product_size_range`	Numerical vector of length 2 specifying the desired length of the resulting amplicons.
`beads_oligo`	Beads-oligo-dT sequence for the used droplet sequencing protocol (10x, Drop-seq). If nothing is specified (`beads_oligo = NA`), the 10x V3 Beads-oligo-dT sequence is used. Can be changed if primers are for instance designed for Drop-seq. Any barcode bases need to be replaced by `N`.
`reverse_primer`	Reverse primer sequence used for all PCR reactions. Default is the 10x primer sequence: `CTACACGACGCTCTTCCGATCT`.
`target_annot`	(optional) A named `GRangesList` object with transcript annotations in case the targets are transcripts of gene loci. If provided, each `GRanges` within the list should contain all exons of one targeted transcripts. Names need to be the same as for `target_sequences`.
`primer_num_return`	How many forward primers should be designed? (default: 5)
`min_primer_region`	Minimum sequence length required for primer design. Mostly relevant in case a sequence template is too short to allow the specified `product_size_range`.
`primer_opt_tm, primer_min_tm, primer_max_tm`	Optimal, minumum and maximum primer melting temperature. Set to NA to use Primer3s default values.

TsIOList object.

# chromosome 11 truncated transcript sequences and annotations
data("chr11_truncated_txs_seq")

# create TsIOList object for primer design from target sequences
obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500))
obj

# transcript annotations can be added for optional genome browser tracks of designed primers
data("chr11_truncated_txs")
obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500),
                   target_annot = chr11_truncated_txs)

# create input for primer design with Drop-seq instead of default 10x
ds_oligo <- "TTTTTTTAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"
ds_rev_primer <- "AAGCAGTGGTATCAACGCAGAGT"
ds_obj <- TAPseqInput(chr11_truncated_txs_seq, beads_oligo = ds_oligo,
                      reverse_primer = ds_rev_primer, product_size_range = c(350, 500),
                      primer_opt_tm = 62, primer_min_tm = 57, primer_max_tm = 65)