Nothing
The goal of UMI4Cats is to provide and easy-to-use package to analyze UMI-4C contact data.
You can install the latest release of UMI4Cats
from Bioconductor:
if (!requireNamespace("BiocManager", quietly = TRUE))
install.packages("BiocManager")
BiocManager::install("UMI4Cats")
If you want to test the development version, you can install it from the github repository:
BiocManager::install("Pasquali-lab/UMI4Cats")
Now you can load the package using library(UMI4Cats)
.
For detailed instructions on how to use UMI4Cats, please see the vignette.
library(UMI4Cats)
## 0) Download example data -------------------------------
path <- downloadUMI4CexampleData()
## 1) Generate Digested genome ----------------------------
# The selected RE in this case is DpnII (|GATC), so the cut_pos is 0, and the res_enz "GATC".
hg19_dpnii <- digestGenome(
cut_pos = 0,
res_enz = "GATC",
name_RE = "DpnII",
ref_gen = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19,
out_path = file.path(tempdir(), "digested_genome/")
)
## 2) Process UMI-4C fastq files --------------------------
raw_dir <- file.path(path, "CIITA", "fastq")
contactsUMI4C(
fastq_dir = raw_dir,
wk_dir = file.path(path, "CIITA"),
bait_seq = "GGACAAGCTCCCTGCAACTCA",
bait_pad = "GGACTTGCA",
res_enz = "GATC",
cut_pos = 0,
digested_genome = hg19_dpnii,
bowtie_index = file.path(path, "ref_genome", "ucsc.hg19.chr16"),
ref_gen = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19,
threads = 5
)
## 3) Get filtering and alignment stats -------------------
statsUMI4C(wk_dir = file.path(path, "CIITA"))
## 4) Analyze UMI-4C results ------------------------------
# Load sample processed file paths
files <- list.files(file.path(path, "CIITA", "count"),
pattern = "*_counts.tsv",
full.names = TRUE
)
# Create colData including all relevant information
colData <- data.frame(
sampleID = gsub("_counts.tsv.gz", "", basename(files)),
file = files,
stringsAsFactors = FALSE
)
library(tidyr)
colData <- colData %>%
separate(sampleID,
into = c("condition", "replicate", "viewpoint"),
remove = FALSE
)
# Load UMI-4C data and generate UMI4C object
umi <- makeUMI4C(
colData = colData,
viewpoint_name = "CIITA",
grouping = "condition"
)
## 5) Perform differential test ---------------------------
umi <- fisherUMI4C(umi,
grouping = "condition",
filter_low = 20
)
## 6) Plot results ----------------------------------------
plotUMI4C(umi,
grouping = "condition",
ylim = c(0, 15),
xlim = c(10.75e6, 11.25e6)
)
Please note that the UMI4Cats project is released with a Contributor Code of Conduct. By contributing to this project, you agree to abide by its terms.
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.