contactsUMI4C: UMI4C Contacts Processing

In UMI4Cats: UMI4Cats: Processing, analysis and visualization of UMI-4C chromatin contact data

Description

Using demultiplexed FastQ files as input, performs all necessary steps to end up with a tsv file summarizing the restriction enzyme fragments and the number of UMIs supporting that specific contact with the viewpoint (bait) of interest.

Usage

contactsUMI4C(
  fastq_dir,
  wk_dir,
  file_pattern = NULL,
  bait_seq,
  bait_pad,
  res_enz,
  cut_pos,
  digested_genome,
  bowtie_index,
  threads = 1,
  numb_reads = 1e+11,
  rm_tmp = TRUE,
  min_flen = 20,
  filter_bp = 1e+07,
  ref_gen,
  sel_seqname = NULL
)

Arguments

fastq_dir	Path of the directory containing the FastQ files (compressed or uncompressed).
wk_dir	Working directory where to save the outputs generated by the UMI-4c analysis.
file_pattern	Character that can be used to filter the files you want to analyze in the fastq_dir.
bait_seq	Character containing the bait primer sequence.
bait_pad	Character containing the pad sequence (sequence between the bait primer and the restriction enzyme sequence).
res_enz	Character containing the restriction enzyme sequence.
cut_pos	Numeric indicating the nucleotide position where restriction enzyme cuts (zero-based) (for example, for DpnII is 0).
digested_genome	Path for the digested genome file generated using the digestGenome function.
bowtie_index	Path and prefix of the bowtie index to use for the alignment.
threads	Number of threads to use in the analysis. Default=1.
numb_reads	Number of lines from the FastQ file to load in each loop. If having memory size problems, change it to a smaller number. Default=10e10.
rm_tmp	Logical indicating whether to remove temporary files (sam and intermediate bams). TRUE or FALSE. Default=TRUE.
min_flen	Minimal fragment length to use for selecting the fragments. Default=20
filter_bp	Integer indicating the bp upstream and downstream of the viewpoint to select for further analysis. Default=10e6
ref_gen	A BSgenome object of the reference genome.
sel_seqname	A character with the chromosome name to focus the search for the viewpoint sequence.

Value

This function is a combination of calls to other functions that perform the necessary steps for processing UMI-4C data.

Examples

if (interactive()) {
path <- downloadUMI4CexampleData()

hg19_dpnii <- digestGenome(
    cut_pos = 0,
    res_enz = "GATC",
    name_RE = "DpnII",
    ref_gen = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19,
    out_path = file.path(path, "digested_genome")
)


raw_dir <- file.path(path, "CIITA", "fastq")

contactsUMI4C(
    fastq_dir = raw_dir,
    wk_dir = file.path(path, "CIITA"),
    bait_seq = "GGACAAGCTCCCTGCAACTCA",
    bait_pad = "GGACTTGCA",
    res_enz = "GATC",
    cut_pos = 0,
    digested_genome = hg19_dpnii,
    bowtie_index = file.path(path, "ref_genome", "ucsc.hg19.chr16"),
    threads = 1,
    numb_reads = 10e10,
    ref_gen = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19,
    sel_seqname = "chr16"
)

unlink(path, recursive=TRUE)
}

UMI4Cats documentation built on Dec. 31, 2020, 2:01 a.m.