Nothing
R/melting.R
In rmelting: R Interface to MELTING 5
Defines functions
melting
Documented in
melting
#' Compute melting temperature of a nucleic acid duplex
#'
#' Compute the enthalpy and entropy of helix-coil transition, and then the
#' melting temperature of a nucleic acid duplex with the
#' \href{https://www.ebi.ac.uk/biomodels/tools/melting/}{MELTING 5 software} (Le
#' Novère, 2001; Dumousseau et al., 2012).
#'
#' @usage melting(sequence, comp.sequence = NULL,
#' nucleic.acid.conc,
#' hybridisation.type = c("dnadna", "rnarna", "dnarna",
#' "rnadna", "mrnarna", "rnamrna"),
#' Na.conc, Mg.conc, Tris.conc, K.conc,
#' dNTP.conc, DMSO.conc, formamide.conc,
#' size.threshold = 60, force.self = FALSE, correction.factor,
#' method.approx = c("ahs01", "che93", "che93corr",
#' "schdot", "owe69", "san98",
#' "wetdna91", "wetrna91", "wetdnarna91"),
#' method.nn = c("all97", "bre86", "san04", "san96", "sug96",
#' "tan04", "fre86", "xia98", "sug95", "tur06"),
#' method.GU = c("tur99", "ser12"),
#' method.singleMM = c("allsanpey", "tur06", "zno07", "zno08", "wat11"),
#' method.tandemMM = c("allsanpey", "tur99"),
#' method.single.dangle = c("bom00", "sugdna02", "sugrna02", "ser08"),
#' method.double.dangle = c("sugdna02", "sugrna02", "ser05", "ser06"),
#' method.long.dangle = c("sugdna02", "sugrna02"),
#' method.internal.loop = c("san04", "tur06", "zno07"),
#' method.single.bulge.loop = c("tan04", "san04", "ser07" ,"tur06"),
#' method.long.bulge.loop = c("san04", "tur06"),
#' method.CNG = c("bro05"),
#' method.inosine = c("san05", "zno07"),
#' method.hydroxyadenine = c("sug01"),
#' method.azobenzenes = c("asa05"),
#' method.locked = c("mct04"),
#' correction.ion = c("ahs01", "kam71", "marschdot",
#' "owc1904", "owc2004", "owc2104",
#' "owc2204", "san96", "san04", "schlif",
#' "tanna06", "tanna07", "wet91",
#' "owcmg08", "tanmg06", "tanmg07",
#' "owcmix08", "tanmix07"),
#' method.Naeq = c("ahs01", "mit96", "pey00"),
#' correction.DMSO = c("ahs01", "cul76", "esc80", "mus81"),
#' correction.formamide = c("bla96", "lincorr"))
#'
#' @section Mandatory arguments: The following are the arguments which are
#' mandatory for computation. \describe{ \item{\code{sequence}}{5' to 3'
#' sequence of one strand of the nucleic acid duplex as a character string.
#' Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL. U and T are
#' not considered identical (see \strong{Recognized nucleotides}).}
#' \item{\code{comp.sequence}}{Mandatory if there are mismatches, inosine(s)
#' or hydroxyadenine(s) between the two strands. If not specified, it is
#' computed as the complement of \code{sequence}. Self-complementarity in
#' \code{sequence} is detected even though there may be (are) dangling end(s)
#' and \code{comp.sequence} is computed (see \strong{Self complementary
#' sequences}).} \item{\code{nucleic.acid.conc}}{See \strong{Correction factor
#' for nucleic acid concentration.}} \item{\code{Na.conc, Mg.conc, Tris.conc,
#' K.conc}}{At least one cation (Na, Mg, Tris, K) concentration is mandatory,
#' the other agents(dNTP, DMSO, formamide) are optional (see \strong{Ion and
#' agent concentrations}).} \item{\code{hybridisation.type}}{See
#' \strong{Hybridisation type options.}} }
#'
#' @section Recognized nucleotides: \tabular{ll}{ \strong{Code} \tab
#' \strong{Type} \cr A \tab Adenine \cr C \tab Cytosine \cr G \tab Guanine \cr
#' T \tab Thymine \cr U \tab Uracil \cr I \tab Inosine \cr X_C \tab Trans
#' azobenzenes \cr X_T \tab Cis azobenzenes \cr A* \tab Hydroxyadenine \cr AL
#' \tab Locked nucleic acid\cr TL \tab " \cr GL \tab " \cr CL \tab " }
#'
#' U and T are not considered identical.
#'
#' @section Hybridisation type options: The details of the possible options for
#' hybridisation type specified in the argument \code{hybridisation.type} are
#' as follows:
#'
#' \tabular{lll}{ \strong{Option} \tab \strong{\code{Sequence}} \tab
#' \strong{\code{Complementary sequence}}\cr \code{dnadna} \tab DNA \tab DNA
#' \cr \code{rnarna} \tab RNA \tab RNA \cr \code{dnarna} \tab DNA \tab RNA \cr
#' \code{rnadna} \tab RNA \tab DNA \cr \code{mrnarna} \tab 2-o-methyl RNA \tab
#' RNA \cr \code{rnamrna} \tab RNA \tab 2-o-methyl RNA }
#'
#' This parameter determines the nature of the sequences in the arguments
#' \code{sequence} and \code{comp.sequence}.
#'
#' @section Ion and agent concentrations: Ion concentrations are specified by
#' the arguments \code{Na.conc}, \code{Mg.conc}, \code{Tris.conc} and
#' \code{K.conc}, while agent concentrations are specified by the arguments
#' \code{dNTP.conc}, \code{DMSO.conc} and \code{formamide.conc}.
#'
#' These values are used for different correction functions which
#' approximately adjusts for effects of these ions (Na, Mg, Tris, K) and/or
#' agents (dNTP, DMSO, formamide) on on thermodynamic stability of nucleic
#' acid duplexes. Their concentration limits depends on the correction method
#' used. All the concentrations must be in M, except for the DMSO (\%) and
#' formamide (\% or M depending on the correction method). Note that
#' \ifelse{html}{\out{[Tris<sup>+</sup>]}}{\eqn{[\textnormal{Tris}^{+}]}} is
#' about half of the total tris buffer concentration.
#'
#' @section Self complementary sequences: Self complementarity for perfect
#' matching sequences or sequences with dangling ends is detected
#' automatically. However it can be enforced by the argument \code{force.self
#' = TRUE}.
#'
#' @section Correction factor for nucleic acid concentration: For self
#' complementary sequences (Auto detected or specified by \code{force.self})
#' it is 1. Otherwise it is 4 if the both strands are present in equivalent
#' amount and 1 if one strand is in excess.
#'
#' @section Approximative estimation formulas: \tabular{llll}{
#' \strong{Formula}\tab \strong{Type} \tab \strong{Limits/Remarks}\tab
#' \strong{Reference}\cr \code{ahs01}\tab DNA\tab No mismatch \tab von Ahsen
#' et al., 2001 \cr \code{che93}\tab DNA\tab No mismatch; Na=0, Mg=0.0015,
#' \tab Marmur and Doty, 1962\cr \tab \tab Tris=0.01, K=0.05 \tab \cr
#' \code{che93corr}\tab DNA\tab No mismatch; Na=0, Mg=0.0015, \tab Marmur and
#' Doty, 1962\cr \tab \tab Tris=0.01, K=0.05 \tab \cr \code{schdot}\tab
#' DNA\tab No mismatch \tab Wetmur, 1991; Marmur and \cr \tab \tab \tab Doty,
#' 1962; Chester and\cr \tab \tab \tab Marshak, 1993; Schildkraut \cr \tab
#' \tab \tab and Lifson, 1965; Wahl et\cr \tab \tab \tab al., 1987; Britten et
#' al., \cr \tab \tab \tab 1974; Hall et al., 1980\cr \code{owe69}\tab DNA\tab
#' No mismatch \tab Owen et al., 1969; \cr \tab \tab \tab Frank-Kamenetskii,
#' 1971; \cr \tab \tab \tab Blake, 1996; Blake and \cr \tab \tab \tab
#' Delcourt, 1998 \cr \code{san98}\tab DNA\tab No mismatch \tab SantaLucia,
#' 1998; von Ahsen\cr \tab \tab \tab et al., 2001 \cr \code{wetdna91}*\tab
#' DNA\tab \tab Wetmur, 1991 \cr \code{wetrna91}*\tab RNA\tab \tab Wetmur,
#' 1991 \cr \code{wetdnarna91}* \tab DNA/RNA\tab \tab Wetmur, 1991 } * Default
#' formula for computation.
#'
#' Note that calculation is increasingly incorrect when the length of the
#' duplex decreases. Further, it does not take into account nucleic acid
#' concentration.
#'
#' @section Nearest neighbor models:
#'
#' \subsection{Perfectly matching sequences}{\tabular{llll}{ \strong{Model}
#' \tab \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference}\cr
#' \code{all97}*\tab DNA\tab \tab Allawi and SantaLucia, 1997\cr
#' \code{tur06}*\tab 2'-O-MeRNA/\tab A sodium correction\tab Kierzek et al.,
#' 2006 \cr \tab RNA\tab (\code{san04}) is \tab \cr \tab \tab automatically
#' applied to \tab \cr \tab \tab convert the entropy (Na =\tab \cr \tab \tab
#' 0.1M) into the entropy (Na = \tab \cr \tab \tab 1M). \tab \cr \code{bre86}
#' \tab DNA\tab \tab Breslauer et al., 1986 \cr \code{san04} \tab DNA\tab \tab
#' SantaLucia and Hicks, 2004 \cr \code{san96} \tab DNA\tab \tab SantaLucia et
#' al., 1996\cr \code{sug96} \tab DNA\tab \tab Sugimoto et al., 1996\cr
#' \code{tan04} \tab DNA\tab \tab Tanaka et al., 2004\cr \code{fre86} \tab
#' RNA\tab \tab Freier et al., 1986\cr \code{xia98}*\tab RNA\tab \tab Xia et
#' al., 1998 \cr \code{sug95}*\tab DNA/ \tab \tab SantaLucia et al., 1996\cr
#' \tab RNA\tab \tab } * Default model for computation.}
#'
#' \subsection{GU wobble base pairs effect}{\tabular{llll}{ \strong{Model}
#' \tab \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference} \cr
#' \code{tur99} \tab RNA\tab \tab Mathews et al., 1999 \cr \code{ser12}* \tab
#' RNA\tab \tab Chen et al., 2012 } * Default model for computation.
#'
#' GU base pairs are not taken into account by the approximative mode.}
#'
#' \subsection{Single mismatch effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{allsanpey}* \tab DNA \tab \tab Allawi and SantaLucia, 1997;\cr \tab
#' \tab \tab Allawi and SantaLucia, 1998;\cr \tab \tab \tab Allawi and
#' SantaLucia, 1998;\cr \tab \tab \tab Allawi and SantaLucia, 1998;\cr \tab
#' \tab \tab Peyret et al., 1999 \cr \code{wat11}* \tab DNA/RNA \tab \tab
#' Watkins et al., 2011 \cr \code{tur06} \tab RNA \tab \tab Lu et al., 2006
#' \cr \code{zno07}* \tab RNA \tab \tab Davis and Znosko, 2007 \cr
#' \code{zno08} \tab RNA \tab At least one adjacent GU base \tab Davis and
#' Znosko, 2008 \cr \tab \tab pair. \tab } * Default model for computation.
#'
#' Single mismatches are not taken into account by the approximative mode.}
#'
#' \subsection{Tandem mismatches effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{allsanpey}* \tab DNA \tab Only GT mismatches and TA/TG \tab Allawi
#' and SantaLucia, 1997;\cr \tab \tab mismatches. \tab Allawi and SantaLucia,
#' 1998;\cr \tab \tab \tab Allawi and SantaLucia, 1998;\cr \tab \tab \tab
#' Allawi and SantaLucia, 1998;\cr \tab \tab \tab Peyret et al., 1999 \cr
#' \code{tur99}* \tab RNA \tab No adjacent GU or UG base \tab Mathews et al.,
#' 1999; Lu et \cr \tab \tab pairs. \tab al., 2006 } * Default model for
#' computation.
#'
#' Tandem mismatches are not taken into account by the approximative mode.
#' Note that not all the mismatched Crick's pairs have been investigated.}
#'
#' \subsection{Single dangling end effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{bom00}* \tab DNA \tab \tab Bommarito et al., 2000 \cr \code{sugdna02}
#' \tab DNA \tab Only terminal poly A self \tab Ohmichi et al., 2002 \cr \tab
#' \tab complementary sequences. \tab \cr \code{sugrna02} \tab RNA \tab Only
#' terminal poly A self \tab Ohmichi et al., 2002 \cr \tab \tab complementary
#' sequences. \tab \cr \code{ser08}* \tab RNA \tab Only 3' UA, GU and UG \tab
#' O'Toole et al., 2006; Miller\cr \tab \tab terminal base pairs only 5' \tab
#' et al., 2008 \cr \tab \tab UG and GU terminal base \tab \cr \tab \tab
#' pairs. \tab } * Default model for computation.
#'
#' Single dangling ends are not taken into account by the approximative mode.}
#'
#' \subsection{Double dangling end effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference} \cr
#' \code{sugdna02}* \tab DNA\tab Only terminal poly A self\tab Ohmichi et al.,
#' 2002\cr \tab \tab complementary sequences. \tab \cr \code{sugrna02}\tab
#' RNA\tab Only terminal poly A self\tab Ohmichi et al., 2002\cr \tab \tab
#' complementary sequences. \tab \cr \code{ser05} \tab RNA\tab Depends on the
#' available \tab O'Toole et al., 2005\cr \tab \tab thermodynamic parameters
#' for \tab \cr \tab \tab single dangling end. \tab \cr \code{ser06}*\tab
#' RNA\tab \tab O'Toole et al., 2006 } * Default model for computation.
#'
#' Double dangling ends are not taken into account by the approximative mode.}
#'
#' \subsection{Long dangling end effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference} \cr
#' \code{sugdna02}* \tab DNA\tab Only terminal poly A self \tab Ohmichi et
#' al., 2002\cr \tab \tab complementary sequences.\tab \cr \code{sugrna02}*
#' \tab RNA\tab Only terminal poly A self \tab Ohmichi et al., 2002\cr \tab
#' \tab complementary sequences.\tab } * Default model for computation.
#'
#' Long dangling ends are not taken into account by the approximative mode.}
#'
#' \subsection{Internal loop effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{san04}* \tab DNA \tab Missing asymmetry penalty. \tab SantaLucia and
#' Hicks, 2004\cr \tab \tab Not tested with experimental \tab \cr \tab \tab
#' results. \tab \cr \code{tur06} \tab RNA \tab Not tested with experimental
#' \tab Lu et al., 2006 \cr \tab \tab results. \tab \cr \code{zno07}* \tab RNA
#' \tab Only for 1x2 loop. \tab Badhwar et al., 2007 } * Default model for
#' computation.
#'
#' Internal loops are not taken into account by the approximative mode.}
#'
#' \subsection{Single bulge loop effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference} \cr
#' \code{tan04}*\tab DNA\tab \tab Tan and Chen, 2007\cr \code{san04} \tab
#' DNA\tab Missing closing AT penalty. \tab SantaLucia and Hicks, 2004\cr
#' \code{ser07} \tab RNA\tab Less reliable results. Some \tab Blose et al.,
#' 2007\cr \tab \tab missing parameters. \tab \cr \code{tur06}*\tab RNA\tab
#' \tab Lu et al., 2006 } * Default model for computation.
#'
#' Single bulge loops are not taken into account by the approximative mode.}
#'
#' \subsection{Long bulge loop effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{san04}* \tab DNA \tab Missing closing AT penalty. \tab SantaLucia and
#' Hicks, 2004 \cr \code{tur06}* \tab RNA \tab Not tested with experimental
#' \tab Mathews et al., 1999; Lu et\cr \tab \tab results. \tab al., 2006 } *
#' Default model for computation.
#'
#' Long bulge loops are not taken into account by the approximative mode.}
#'
#' \subsection{CNG repeats effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference}\cr
#' \code{bro05}*\tab RNA\tab Self complementary sequences. \tab Broda et al.,
#' 2005 \cr \tab \tab 2 to 7 CNG repeats. \tab } * Default model for
#' computation.
#'
#' CNG repeats are not taken into account by the approximative mode. The
#' contribution of CNG repeats to the thermodynamic of helix-coil transition
#' can be computed only for 2 to 7 CNG repeats. N represents a single mismatch
#' of type N/N.}
#'
#' \subsection{Inosine bases effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference} \cr
#' \code{san05}*\tab DNA\tab Missing parameters for tandem \tab Watkins and
#' SantaLucia, 2005\cr \tab \tab base pairs containing inosine \tab \cr \tab
#' \tab bases.\tab \cr \code{zno07}*\tab RNA\tab Only IU base pairs. \tab
#' Wright et al., 2007 } * Default model for computation.
#'
#' Inosine bases (I) are not taken into account by the approximative mode.}
#'
#' \subsection{Hydroxyadenine bases effect}{\tabular{llll}{ \strong{Model}
#' \tab \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference}\cr
#' \code{sug01}*\tab DNA\tab Only 5' GA*C 3'and 5' TA*A 3' \tab Kawakami et
#' al., 2001\cr \tab \tab contexts. \tab } * Default model for computation.
#'
#' Hydroxyadenine bases (A*) are not taken into account by the approximative
#' mode.}
#'
#' \subsection{Azobenzenes effect effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference} \cr
#' \code{asa05}*\tab DNA\tab Less reliable results when \tab Asanuma et al.,
#' 2005\cr \tab \tab the number of cis azobenzene \tab \cr \tab \tab
#' increases. \tab } * Default model for computation.
#'
#' Azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) are not
#' taken into account by the approximative mode.}
#'
#' \subsection{Locked nucleic acids effect}{\tabular{llll}{ \strong{Model}
#' \tab \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference} \cr
#' \code{mct04}* \tab DNA \tab \tab McTigue et al., 2004 } * Default model for
#' computation.
#'
#' Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the
#' approximative mode.}
#'
#' @section Ion corrections:
#'
#' \subsection{Sodium corrections}{\tabular{llll}{ \strong{Correction} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{ahs01} \tab DNA \tab Na>0. \tab von Ahsen et al., 2001 \cr
#' \code{schlif} \tab DNA \tab Na>=0.07; Na<=0.12. \tab Schildkraut and
#' Lifson, 1965\cr \code{tanna06} \tab DNA \tab Na>=0.001; Na<=1. \tab Tan and
#' Chen, 2006 \cr \code{tanna07}* \tab RNA \tab Na>=0.003; Na<=1. \tab Tan and
#' Chen, 2007 \cr \tab or \tab \tab \cr \tab 2'-O-MeRNA/RNA \tab \tab \cr
#' \code{wet91} \tab RNA, \tab Na>0. \tab Wetmur, 1991 \cr \tab DNA \tab \tab
#' \cr \tab and \tab \tab \cr \tab RNA/DNA \tab \tab \cr \code{kam71} \tab DNA
#' \tab Na>0; Na>=0.069; Na<=1.02. \tab Frank-Kamenetskii, 1971 \cr
#' \code{marschdot} \tab DNA \tab Na>=0.069; Na<=1.02. \tab Marmur and Doty,
#' 1962; Blake\cr \tab \tab \tab and Delcourt, 1998 \cr \code{owc1904} \tab
#' DNA \tab Na>0. (equation 19) \tab Owczarzy et al., 2004 \cr \code{owc2004}
#' \tab DNA \tab Na>0. (equation 20) \tab Owczarzy et al., 2004 \cr
#' \code{owc2104} \tab DNA \tab Na>0. (equation 21) \tab Owczarzy et al., 2004
#' \cr \code{owc2204}* \tab DNA \tab Na>0. (equation 22) \tab Owczarzy et al.,
#' 2004 \cr \code{san96} \tab DNA \tab Na>=0.1. \tab SantaLucia et al., 1996
#' \cr \code{san04} \tab DNA \tab Na>=0.05; Na<=1.1; \tab SantaLucia and
#' Hicks, 2004; \cr \tab \tab Oligonucleotides inferior to \tab SantaLucia,
#' 1998 \cr \tab \tab 16 bases. \tab }} * Default correction method for
#' computation.
#'
#' \subsection{Magnesium corrections}{\tabular{llll}{ \strong{Correction} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference}\cr
#' \code{owcmg08}*\tab DNA\tab Mg>=0.0005; Mg<=0.6.\tab Owczarzy et al.,
#' 2008\cr \code{tanmg06} \tab DNA\tab Mg>=0.0001; Mg<=1; Oligomer \tab Tan
#' and Chen, 2006 \cr \tab \tab length superior to 6 base \tab \cr \tab \tab
#' pairs.\tab \cr \code{tanmg07}*\tab RNA\tab Mg>=0.1; Mg<=0.3. \tab Tan and
#' Chen, 2007 }} * Default correction method for computation.
#'
#' \subsection{Mixed Sodium and Magnesium corrections}{\tabular{llll}{
#' \strong{Correction} \tab \strong{Type} \tab \strong{Limits.Remarks} \tab
#' \strong{Reference} \cr \code{owcmix08}* \tab DNA \tab Mg>=0.0005; Mg<=0.6;
#' \tab Owczarzy et al., 2008\cr \tab \tab Na+K+Tris/2>0. \tab \cr
#' \code{tanmix07} \tab DNA, \tab Mg>=0.1; Mg<=0.3; \tab Tan and Chen, 2007
#' \cr \tab RNA \tab Na+K+Tris/2>=0.1; \tab \cr \tab or \tab Na+K+Tris/2<=0.3.
#' \tab \cr \tab 2'-O-MeRNA/RNA \tab \tab }} * Default correction method for
#' computation.
#'
#' The ion correction by Owczarzy et al. (2008) is used by default according
#' to the \ifelse{html}{\out{[Mg<sup>2+</sup>]<sup>0.5</sup> ⁄
#' [Mon<sup>+</sup>]}}{\eqn{\frac{[\textnormal{Mg}^{2+}]^{0.5}}{[\textnormal{Mon}^{+}]}}}
#' ratio, where \ifelse{html}{\out{[Mon<sup>+</sup>] = [Na<sup>+</sup>]
#' + [Tris<sup>+</sup>] + [K<sup>+</sup>]
#' }}{\eqn{[\textnormal{Mon}^{+}] =
#' [\textnormal{Na}^{+}]+[\textnormal{Tris}^{+}]+[\textnormal{K}^{+}]}}.
#'
#' If, \describe{
#' \item{\ifelse{html}{\out{[Mon<sup>+</sup>]}}{\eqn{[\textnormal{Mon}^{+}]}}
#' = 0}{Default sodium correction is used.} \item{Ratio < 0.22,}{Default
#' sodium correction is used.} \item{0.22 <= Ratio < 6}{Default mixed Na and
#' Mg correction is used.} \item{Ratio >= 6}{Default magnesium correction is
#' used.} }
#'
#' Note that
#' \ifelse{html}{\out{[Tris<sup>+</sup>]}}{\eqn{[\textnormal{Tris}^{+}]}} is
#' about half of the total tris buffer concentration.
#'
#' \subsection{Sodium equivalent concentration methods}{\tabular{llll}{
#' \strong{Correction} \tab \strong{Type} \tab \strong{Limits/Remarks} \tab
#' \strong{Reference} \cr \code{ahs01}*\tab DNA\tab \tab von Ahsen et al.,
#' 2001\cr \code{mit96} \tab DNA\tab \tab Mitsuhashi, 1996\cr \code{pey00}
#' \tab DNA\tab \tab Peyret, 2000 } * Default correction method for
#' computation.
#'
#' For the other types of hybridization, the DNA default correction is used.
#' If there are other cations when an approximative approach is used, a sodium
#' equivalence is automatically computed. In case of nearest neighbor
#' approach, the sodium equivalence will be used only if a sodium correction
#' is specified by the argument \code{correction.ion}.}
#'
#' @section Denaturing agent corrections:
#'
#' \subsection{DMSO corrections}{\tabular{llll}{ \strong{Correction} \tab
#' \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference}\cr
#' \code{ahs01*} \tab DNA\tab Not tested with experimental \tab von Ahsen et
#' al., 2001 \cr \tab \tab results. \tab \cr \code{cul76} \tab DNA\tab Not
#' tested with experimental \tab Cullen and Bick, 1976\cr \tab \tab results.
#' \tab \cr \code{esc80} \tab DNA\tab Not tested with experimental \tab Escara
#' and Hutton, 1980\cr \tab \tab results. \tab \cr \code{mus81} \tab DNA\tab
#' Not tested with experimental \tab Musielski et al., 1981 \cr \tab \tab
#' results. \tab } * Default correction method for computation.
#'
#' For the other types of hybridization, the DNA default correction is used.
#' If there is DMSO when an approximative approach is used, a DMSO correction
#' is automatically computed. In case of nearest neighbor approach and
#' approximative approach, the DMSO correction will be used only if a sodium
#' correction is specified by the argument \code{correction.ion}.}
#'
#' \subsection{Formamide corrections}{\tabular{llll}{ \strong{Correction} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference} \cr
#' \code{bla96*} \tab DNA\tab With formamide concentration\tab Blake, 1996 \cr
#' \tab \tab in mol/L. \tab \cr \code{lincorr} \tab DNA\tab With a % of
#' formamide volume. \tab McConaughy et al., 1969;\cr \tab \tab \tab Record,
#' 1967; Casey and \cr \tab \tab \tab Davidson, 1977; Hutton, 1977 } * Default
#' correction method for computation.
#'
#' For the other types of hybridization, the DNA default correction is used.
#' If there is formamide when an approximative approach is used, a formamide
#' correction is automatically computed. In case of nearest neighbor approach
#' and approximative approach, the formamide correction will be used only if a
#' sodium correction is specified by the argument \code{correction.ion}.}
#'
#' @param sequence Sequence (5' to 3') of one strand of the nucleic acid duplex
#' as a character string (\strong{Note:} Uridine and thymidine are not
#' considered as identical).
#' @param comp.sequence Complementary sequence (3' to 5') of the nucleic acid
#' duplex as a character string.
#' @param nucleic.acid.conc Concentration of the nucleic acid strand (M or
#' \ifelse{html}{\out{mol L<sup>-1</sup>}}{\eqn{\textrm{mol L}^{-1}}}) in
#' excess as a numeric value.
#' @param hybridisation.type The hybridisation type. Either \code{"dnadna"},
#' \code{"rnarna"}, \code{"dnarna"}, \code{"rnadna"}, \code{"mrnarna"} or
#' \code{"rnamrna"} (see \strong{Hybridisation type options}).
#' @param Na.conc Concentration of Na ions (M) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param Mg.conc Concentration of Mg ions (M) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param Tris.conc Concentration of Tris ions (M) as a positive numeric value
#' (see \strong{Ion and agent concentrations}).
#' @param K.conc Concentration of K ions (M) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param dNTP.conc Concentration of dNTP (M) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param DMSO.conc Concentration of DMSO (\%) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param formamide.conc Concentration of formamide (M or \% depending on
#' correction method) as a positive numeric value (see \strong{Ion and agent
#' concentrations}).
#' @param size.threshold Sequence length threshold to decide approximative or
#' nearest-neighbour approach for computation. Default is 60.
#' @param force.self logical. Enforces that \code{sequence} is self
#' complementary and \code{complementary sequence} is not required (seed
#' \strong{Self complementary sequences}). Default is \code{FALSE}.
#' @param correction.factor Correction factor to be used to modulate the effect
#' of the nucleic acid concentration (\code{nucleic.acid.conc}) in the
#' computation of melting temperature (see \strong{Correction factor for
#' nucleic acid concentration}).
#' @param method.approx Specify the approximative formula to be used for melting
#' temperature calculation for sequences of length greater than
#' \code{size.threshold}. Either \code{"ahs01"}, \code{"che93"},
#' \code{"che93corr"}, \code{"schdot"}, \code{"owe69"}, \code{"san98"},
#' \code{"wetdna91"}, \code{"wetrna91"} or \code{"wetdnarna91"} (see
#' \strong{Approximative formulas}).
#' @param method.nn Specify the nearest neighbor model to be used for melting
#' temperature calculation for perfectly matching sequences of length lesser
#' than \code{size.threshold}. Either \code{"all97"}, \code{"bre86"},
#' \code{"san04"}, \code{"san96"}, \code{"sug96"}, \code{"tan04"},
#' \code{"fre86"}, \code{"xia98"}, \code{"sug95"} or \code{"tur06"} (see
#' \strong{Perfectly matching sequences}).
#' @param method.GU Specify the nearest neighbor model to compute the
#' contribution of GU base pairs to the thermodynamic of helix-coil
#' transition. Either \code{"tur99"} or \code{"ser12"} (see \strong{GU wobble
#' base pairs effect}).
#' @param method.singleMM Specify the nearest neighbor model to compute the
#' contribution of single mismatch to the thermodynamic of helix-coil
#' transition. Either \code{"allsanpey"}, \code{"tur06"}, \code{"zno07"}
#' \code{"zno08"} or \code{"wat11"} (see \strong{Single mismatch effect}).
#' @param method.tandemMM Specify the nearest neighbor model to compute the
#' contribution of tandem mismatches to the thermodynamic of helix-coil
#' transition. Either \code{"allsanpey"} or \code{"tur99"} (see \strong{Tandem
#' mismatches effect}).
#' @param method.single.dangle Specify the nearest neighbor model to compute the
#' contribution of single dangling end to the thermodynamic of helix-coil
#' transition. Either \code{"bom00"}, \code{"sugdna02"}, \code{"sugrna02"} or
#' \code{"ser08"} (see \strong{Single dangling end effect}).
#' @param method.double.dangle Specify the nearest neighbor model to compute the
#' contribution of double dangling end to the thermodynamic of helix-coil
#' transition. Either \code{"sugdna02"}, \code{"sugrna02"}, \code{"ser05"} or
#' \code{"ser06"} (see \strong{Double dangling end effect}).
#' @param method.long.dangle Specify the nearest neighbor model to compute the
#' contribution of long dangling end to the thermodynamic of helix-coil
#' transition. Either \code{"sugdna02"} or \code{"sugrna02"} (see \strong{Long
#' dangling end effect}).
#' @param method.internal.loop Specify the nearest neighbor model to compute the
#' contribution of internal loop to the thermodynamic of helix-coil
#' transition. Either \code{"san04"}, \code{"tur06"} or \code{"zno07"} (see
#' \strong{Internal loop effect}).
#' @param method.single.bulge.loop Specify the nearest neighbor model to compute
#' the contribution of single bulge loop to the thermodynamic of helix-coil
#' transition. Either \code{"san04"}, \code{"tan04"}, \code{"ser07"} or
#' \code{"tur06"} (see \strong{Single bulge loop effect}).
#' @param method.long.bulge.loop Specify the nearest neighbor model to compute
#' the contribution of long bulge loop to the thermodynamic of helix-coil
#' transition. Either \code{"san04"} or \code{"tur06"} (see \strong{Long bulge
#' loop effect}).
#' @param method.CNG Specify the nearest neighbor model to compute the
#' contribution of CNG repeats to the thermodynamic of helix-coil transition.
#' Available method is \code{"bro05"} (see \strong{CNG repeats effect}).
#' @param method.inosine Specify the specific nearest neighbor model to compute
#' the contribution of inosine bases (I) to the thermodynamic of helix-coil
#' transition. Either \code{"san05"} or \code{"zno07"} (see \strong{Inosine
#' bases effect}).
#' @param method.hydroxyadenine Specify the nearest neighbor model to compute
#' the contribution of hydroxyadenine bases (A*) to the thermodynamic of
#' helix-coil transition. Available method is \code{"sug01"} (see
#' \strong{Hydroxyadenine bases effect}).
#' @param method.azobenzenes Specify the nearest neighbor model to compute the
#' contribution of azobenzenes (X_T for trans azobenzenes and X_C for cis
#' azobenzenes) to the thermodynamic of helix-coil transition. Available
#' method is \code{"asa05"} (see \strong{Azobenzenes effect}).
#' @param method.locked Specify the nearest neighbor model to compute the
#' contribution of locked nucleic acids (AL, GL, TL and CL) to the
#' thermodynamic of helix-coil transition. Available method is \code{"mct04"}
#' (see \strong{Locked nucleic acids effect}).
#' @param correction.ion Specify the correction method for ions. Either one of
#' the following: \itemize{\item{Na corrections}{\code{"ahs01"},
#' \code{"kam71"}, \code{"owc1904"}, \code{"owc2004"}, \code{"owc2104"},
#' \code{"owc2204"}, \code{"san96"}, \code{"san04"}, \code{"schlif"},
#' \code{"tanna06"}, \code{"wetdna91"}, \code{"tanna07"}, \code{"wetrna91"} or
#' \code{"wetdnarna91"} (see \strong{Sodium corrections})} \item{Mg
#' corrections}{\code{"owcmg08"}, \code{"tanmg06"} or \code{"tanmg07"} (see
#' \strong{Magnesium corrections})} \item{Mixed Na Mg
#' corrections}{\code{"owcmix08"}, \code{"tanmix07"} or \code{"tanmix07"} (see
#' \strong{Mixed Sodium and Magnesium corrections})} }.
#' @param method.Naeq Specify the ion correction which gives a sodium equivalent
#' concentration if other cations are present. Either \code{"ahs01"},
#' \code{"mit96"} or \code{"pey00"} (see \strong{Sodium equivalent
#' concentration methods}).
#' @param correction.DMSO Specify the correction method for DMSO. Specify the
#' correction method for DMSO. Either \code{"ahs01"}, \code{"mus81"},
#' \code{"cul76"} or \code{"esc80"} (see \strong{DMSO corrections}).
#' @param correction.formamide Specify the correction method for formamide.
#' Specify the correction method for formamide Either \code{"bla96"} or
#' \code{"lincorr"} (see \strong{Formamide corrections}).
#'
#' @return A list with the following components: \item{\code{Environment}}{A
#' list with details about the melting temperature computation environment.}
#' \item{\code{Options}}{A list with details about the options (default or
#' user specified) used for melting temperature computation.}
#' \item{\code{Results}}{A list with the results of the melting temperature
#' computation including the enthalpy and entropy in case of nearest neighbour
#' methods.} \item{\code{Message}}{Error and/or Warning messages, if any.}
#'
#' @export
#' @import rJava
#' @importFrom Rdpack reprompt
#' @encoding UTF-8
#'
#' @references
#'
#' \insertRef{marmur_determination_1962}{rmelting}
#'
#' \insertRef{schildkraut_dependence_1965}{rmelting}
#'
#' \insertRef{record_electrostatic_1967}{rmelting}
#'
#' \insertRef{mcconaughy_nucleic_1969}{rmelting}
#'
#' \insertRef{owen_determination_1969}{rmelting}
#'
#' \insertRef{frank-kamenetskii_simplification_1971}{rmelting}
#'
#' \insertRef{britten_analysis_1974}{rmelting}
#'
#' \insertRef{cullen_thermal_1976}{rmelting}
#'
#' \insertRef{hutton_renaturation_1977}{rmelting}
#'
#' \insertRef{casey_rates_1977}{rmelting}
#'
#' \insertRef{hall_evolution_1980}{rmelting}
#'
#' \insertRef{escara_thermal_1980}{rmelting}
#'
#' \insertRef{musielski_influence_1981}{rmelting}
#'
#' \insertRef{freier_improved_1986}{rmelting}
#'
#' \insertRef{breslauer_predicting_1986}{rmelting}
#'
#' \insertRef{wahl_molecular_1987}{rmelting}
#'
#' \insertRef{wetmur_dna_1991}{rmelting}
#'
#' \insertRef{chester_dimethyl_1993}{rmelting}
#'
#' \insertRef{sugimoto_rna/dna_1994}{rmelting}
#'
#' \insertRef{sugimoto_thermodynamic_1995}{rmelting}
#'
#' \insertRef{santalucia_improved_1996}{rmelting}
#'
#' \insertRef{sugimoto_improved_1996}{rmelting}
#'
#' \insertRef{blake_thermodynamic_1996}{rmelting}
#'
#' \insertRef{blake_denaturation_1996}{rmelting}
#'
#' \insertRef{mitsuhashi_technical_1996}{rmelting}
#'
#' \insertRef{allawi_thermodynamics_1997}{rmelting}
#'
#' \insertRef{santalucia_unified_1998}{rmelting}
#'
#' \insertRef{xia_thermodynamic_1998}{rmelting}
#'
#' \insertRef{allawi_thermodynamics_1998}{rmelting}
#'
#' \insertRef{blake_thermal_1998}{rmelting}
#'
#' \insertRef{allawi_nearest_1998}{rmelting}
#'
#' \insertRef{allawi_nearest-neighbor_1998}{rmelting}
#'
#' \insertRef{mathews_expanded_1999}{rmelting}
#'
#' \insertRef{peyret_nearest-neighbor_1999}{rmelting}
#'
#' \insertRef{peyret_prediction_2000}{rmelting}
#'
#' \insertRef{bommarito_thermodynamic_2000}{rmelting}
#'
#' \insertRef{kawakami_thermodynamic_2001}{rmelting}
#'
#' \insertRef{von_ahsen_oligonucleotide_2001}{rmelting}
#'
#' \insertRef{le_novere_melting_2001}{rmelting}
#'
#' \insertRef{ohmichi_long_2002}{rmelting}
#'
#' \insertRef{santalucia_thermodynamics_2004}{rmelting}
#'
#' \insertRef{tanaka_thermodynamic_2004}{rmelting}
#'
#' \insertRef{mctigue_sequence-dependent_2004}{rmelting}
#'
#' \insertRef{owczarzy_effects_2004}{rmelting}
#'
#' \insertRef{broda_thermodynamic_2005}{rmelting}
#'
#' \insertRef{watkins_nearest-neighbor_2005}{rmelting}
#'
#' \insertRef{asanuma_clear-cut_2005}{rmelting}
#'
#' \insertRef{otoole_stability_2005}{rmelting}
#'
#' \insertRef{lu_set_2006}{rmelting}
#'
#' \insertRef{kierzek_nearest_2006}{rmelting}
#'
#' \insertRef{tan_nucleic_2006}{rmelting}
#'
#' \insertRef{otoole_comprehensive_2006}{rmelting}
#'
#' \insertRef{tan_rna_2007}{rmelting}
#'
#' \insertRef{wright_nearest_2007}{rmelting}
#'
#' \insertRef{davis_thermodynamic_2007}{rmelting}
#'
#' \insertRef{blose_non-nearest-neighbor_2007}{rmelting}
#'
#' \insertRef{badhwar_thermodynamic_2007}{rmelting}
#'
#' \insertRef{davis_thermodynamic_2008}{rmelting}
#'
#' \insertRef{miller_thermodynamic_2008}{rmelting}
#'
#' \insertRef{owczarzy_predicting_2008}{rmelting}
#'
#' \insertRef{watkins_thermodynamic_2011}{rmelting}
#'
#' \insertRef{chen_testing_2012}{rmelting}
#'
#' \insertRef{dumousseau_melting_2012}{rmelting}
#'
#' @seealso For more details about algorithm, formulae and methods, see the
#' documentation for
#' \href{https://www.ebi.ac.uk/biomodels-static/tools/melting/melting5-doc/melting.html}{MELTING
#' 5}.
#'
#' @examples
#'
#' # Basic usage
#' melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
#' hybridisation.type = "dnadna", Na.conc = 1)
#'
#' # For more detailed examples refer the vignette.
#' \dontrun{
#'
#' browseVignettes(package = 'rmelting')
#' }
#'
melting <- function(sequence, comp.sequence = NULL,
nucleic.acid.conc,
hybridisation.type = c("dnadna", "rnarna", "dnarna",
"rnadna", "mrnarna", "rnamrna"),
Na.conc, Mg.conc, Tris.conc, K.conc,
dNTP.conc, DMSO.conc, formamide.conc,
size.threshold = 60, force.self = FALSE, correction.factor,
method.approx = c("ahs01", "che93", "che93corr",
"schdot", "owe69", "san98", "wetdna91",
"wetrna91", "wetdnarna91"),
method.nn = c("all97", "bre86", "san04", "san96", "sug96",
"tan04", "fre86", "xia98", "sug95", "tur06"),
method.GU = c("tur99", "ser12"),
method.singleMM = c("allsanpey", "tur06", "zno07",
"zno08", "wat11"),
method.tandemMM = c("allsanpey", "tur99"),
method.single.dangle = c("bom00", "sugdna02",
"sugrna02", "ser08"),
method.double.dangle = c("sugdna02", "sugrna02",
"ser05", "ser06"),
method.long.dangle = c("sugdna02", "sugrna02"),
method.internal.loop = c("san04", "tur06", "zno07"),
method.single.bulge.loop = c("tan04", "san04",
"ser07", "tur06"),
method.long.bulge.loop = c("san04", "tur06"),
method.CNG = c("bro05"),
method.inosine = c("san05", "zno07"),
method.hydroxyadenine = c("sug01"),
method.azobenzenes = c("asa05"), method.locked = c("mct04"),
correction.ion = c("ahs01", "kam71", "marschdot",
"owc1904", "owc2004", "owc2104",
"owc2204", "san96", "san04", "schlif",
"tanna06", "tanna07", "wet91",
"owcmg08", "tanmg06", "tanmg07",
"owcmix08", "tanmix07"),
method.Naeq = c("ahs01", "mit96", "pey00"),
correction.DMSO = c("ahs01", "cul76", "esc80", "mus81"),
correction.formamide = c("bla96", "lincorr")) {
##################################################
# Checks for mandatory arguments
##################################################
#-----------------------------------------------------------------------------
# Check if mandatory argument sequence is present
if (missing(sequence)) {
stop("The mandatory argument 'sequence' is missing.")
}
# Check if sequence is of type character with unit length
if (!is.character(sequence) || length(sequence) != 1) {
stop("'sequence' should be a character vector of length 1.")
}
#-----------------------------------------------------------------------------
# Check if mandatory argument nucleic.acid.conc is present
if (missing(nucleic.acid.conc)) {
stop("The mandatory argument 'nucleic.acid.conc' is missing.")
}
# Check if argument nucleic.acid.conc is of type numeric with unit length
if (!is.numeric(nucleic.acid.conc) || length(nucleic.acid.conc) != 1) {
stop("'nucleic.acid.conc' should be a numeric vector of length 1.")
}
#-----------------------------------------------------------------------------
# Check if mandatory argument hybridisation.type is present
if (missing(hybridisation.type)) {
stop("The mandatory argument 'hybridisation.type' is missing.")
}
# Check argument hybridisation.type
hybridisation.type <- match.arg(hybridisation.type)
# Check if argument hybridisation.type is of type character with unit length
if (!is.character(hybridisation.type) || length(hybridisation.type) != 1) {
stop("'hybridisation.type' should be a character vector of length 1.")
}
#-----------------------------------------------------------------------------
# Check if inosine(s) or hydroxyadenine(s) are present in sequence
if (missing(comp.sequence)) {
i.check <- grepl("i", sequence, ignore.case = TRUE)
ha.check <- grepl("a\\*", sequence, ignore.case = TRUE)
if (TRUE %in% c(i.check, ha.check)) {
stop("The argument 'comp.sequence' is required if there are",
"inosine(s) [I] or hydroxyadenine(s) [A*] in the 'sequence'")
}
}
#-----------------------------------------------------------------------------
# Check if at least one of the ion concentrations are present
ion.check <- c(missing(Na.conc), missing(Mg.conc), missing(Tris.conc),
missing(K.conc))
if (!(FALSE %in% ion.check)) {
stop("At least one of these arguments specifying ion concentration",
"should be provided:",
"\n'Na.conc', 'Mg.conc', 'Tris.conc', 'K.conc'")
}
# Check if argument nucleic.acid.conc is of type numeric with unit length
if (!missing(Na.conc)) {
if (!is.numeric(Na.conc) || length(Na.conc) != 1) {
stop("'Na.conc' should be a numeric vector of length 1.")
}
}
# Check if argument nucleic.acid.conc is of type numeric with unit length
if (!missing(Mg.conc)) {
if (!is.numeric(Mg.conc) || length(Mg.conc) != 1) {
stop("'Mg.conc' should be a numeric vector of length 1.")
}
}
# Check if argument Tris.conc is of type numeric with unit length
if (!missing(Tris.conc)) {
if (!is.numeric(Tris.conc) || length(Tris.conc) != 1) {
stop("'Tris.conc' should be a numeric vector of length 1.")
}
}
# Check if argument K.conc is of type numeric with unit length
if (!missing(K.conc)) {
if (!is.numeric(K.conc) || length(K.conc) != 1) {
stop("'K.conc' should be a numeric vector of length 1.")
}
}
#-----------------------------------------------------------------------------
##################################################
# Checks for other arguments
##################################################
#-----------------------------------------------------------------------------
# Check if argument dNTP.conc is of type numeric with unit length
if (!missing(dNTP.conc)) {
if (!is.numeric(dNTP.conc) || length(dNTP.conc) != 1) {
stop("'dNTP.conc' should be a numeric vector of length 1.")
}
}
# Check if argument DMSO.conc is of type numeric with unit length
if (!missing(DMSO.conc)) {
if (!is.numeric(DMSO.conc) || length(DMSO.conc) != 1) {
stop("'DMSO.conc' should be a numeric vector of length 1.")
}
}
# Check if argument formamide.conc is of type numeric with unit length
if (!missing(formamide.conc)) {
if (!is.numeric(formamide.conc) || length(formamide.conc) != 1) {
stop("'formamide.conc' should be a numeric vector of length 1.")
}
}
#-----------------------------------------------------------------------------
# Check if argument size.threshold is of type numeric with unit length
if (!is.numeric(size.threshold) || length(size.threshold) != 1) {
stop("'size.threshold' should be a numeric vector of length 1.")
}
#-----------------------------------------------------------------------------
# Check argument force.self
if (!missing(force.self)) {
if (!is.logical(force.self) || length(force.self) != 1) {
stop("'force.self' should be logical vector of length 1.")
}
}
#-----------------------------------------------------------------------------
# Check argument correction.factor
if (!missing(correction.factor)) {
if (!is.numeric(correction.factor) || length(correction.factor) != 1) {
stop("'correction.factor' should be numeric vector of length 1.")
}
}
#-----------------------------------------------------------------------------
# Check argument method.approx
if (!missing(method.approx)) {
method.approx <- match.arg(method.approx)
}
# Check argument method.nn
if (!missing(method.nn)) {
method.nn <- match.arg(method.nn)
}
#-----------------------------------------------------------------------------
# Check argument method.GU
if (!missing(method.GU)) {
method.GU <- match.arg(method.GU)
}
#-----------------------------------------------------------------------------
# Check argument method.singleMM
if (!missing(method.singleMM)) {
method.singleMM <- match.arg(method.singleMM)
}
#-----------------------------------------------------------------------------
# Check argument method.tandemMM
if (!missing(method.tandemMM)) {
method.tandemMM <- match.arg(method.tandemMM)
}
#-----------------------------------------------------------------------------
# Check argument method.single.dangle
if (!missing(method.single.dangle)) {
method.single.dangle <- match.arg(method.single.dangle)
}
#-----------------------------------------------------------------------------
# Check argument method.double.dangle
if (!missing(method.double.dangle)) {
method.double.dangle <- match.arg(method.double.dangle)
}
#-----------------------------------------------------------------------------
# Check argument method.long.dangle
if (!missing(method.long.dangle)) {
method.long.dangle <- match.arg(method.long.dangle)
}
#-----------------------------------------------------------------------------
# Check argument method.internal.loop
if (!missing(method.internal.loop)) {
method.internal.loop <- match.arg(method.internal.loop)
}
#-----------------------------------------------------------------------------
# Check argument method.single.bulge.loop
if (!missing(method.single.bulge.loop)) {
method.single.bulge.loop <- match.arg(method.single.bulge.loop)
}
#-----------------------------------------------------------------------------
# Check argument method.long.bulge.loop
if (!missing(method.long.bulge.loop)) {
method.long.bulge.loop <- match.arg(method.long.bulge.loop)
}
#-----------------------------------------------------------------------------
# Check argument method.CNG
if (!missing(method.CNG)) {
method.CNG <- match.arg(method.CNG)
}
#-----------------------------------------------------------------------------
# Check argument method.inosine
if (!missing(method.inosine)) {
method.inosine <- match.arg(method.inosine)
}
#-----------------------------------------------------------------------------
# Check argument method.hydroxyadenine
if (!missing(method.hydroxyadenine)) {
method.hydroxyadenine <- match.arg(method.hydroxyadenine)
}
#-----------------------------------------------------------------------------
# Check argument method.azobenzenes
if (!missing(method.azobenzenes)) {
method.azobenzenes <- match.arg(method.azobenzenes)
}
#-----------------------------------------------------------------------------
# Check argument method.locked
if (!missing(method.locked)) {
method.locked <- match.arg(method.locked)
}
#-----------------------------------------------------------------------------
# Check argument correction.ion
if (!missing(correction.ion)) {
correction.ion <- match.arg(correction.ion)
}
#-----------------------------------------------------------------------------
# Check argument method.Naeq
if (!missing(method.Naeq)) {
method.Naeq <- match.arg(method.Naeq)
}
#-----------------------------------------------------------------------------
# Check argument correction.DMSO
if (!missing(correction.DMSO)) {
correction.DMSO <- match.arg(correction.DMSO)
}
#-----------------------------------------------------------------------------
# Check argument correction.formamide
if (!missing(correction.formamide)) {
correction.formamide <- match.arg(correction.formamide)
}
#-----------------------------------------------------------------------------
##################################################
# Build options - General
##################################################
missing2 <- function(x) {
if (missing(x)) {
NA
} else{
x
}
}
eopt <- data.frame(ion_agent = c("Na", "Mg", "Tris", "K",
"dNTP", "DMSO", "formamide"),
earg = c("Na.conc", "Mg.conc", "Tris.conc", "K.conc",
"dNTP.conc", "DMSO.conc", "formamide.conc"),
echeck = c(missing(Na.conc), missing(Mg.conc),
missing(Tris.conc), missing(K.conc),
missing(dNTP.conc), missing(DMSO.conc),
missing(formamide.conc)),
eval = c(missing2(Na.conc), missing2(Mg.conc),
missing2(Tris.conc), missing2(K.conc),
missing2(dNTP.conc), missing2(DMSO.conc),
missing2(formamide.conc)),
stringsAsFactors = FALSE)
# eopt <- data.frame(ion_agent = c("Na", "Mg", "Tris", "K",
# "dNTP", "DMSO", "formamide"),
# earg = c("Na.conc", "Mg.conc", "Tris.conc", "K.conc",
# "dNTP.conc", "DMSO.conc", "formamide.conc"),
# echeck = tf(0.05,0.25),
# eval = tf2(0.05,0.25))
eopt <- eopt[eopt$echeck == FALSE, ]
# Generate input for -E
eopts <- paste(paste0(eopt$ion_agent, "=", eopt$eval), collapse = ":")
# Mandatory options 1
opts <- c(
"-S", sequence,
"-H", hybridisation.type,
"-P", nucleic.acid.conc,
"-E", eopts
)
# Mandatory options 2: comp.sequence
if (!missing(comp.sequence)) {
opts <- c(opts,
"-C", comp.sequence)
}
# General options: size.threshold
opts <- c(opts, "-T", size.threshold)
# General options: force.self
if (force.self) {
opts <- c(opts, "-self")
}
# General options: correction.factor
if (!missing(correction.factor)) {
opts <- c(opts, "-F", correction.factor)
}
##################################################
# Build options - Specific
##################################################
# Options: method.approx
if (!missing(method.approx)) {
opts <- c(opts, "-am", method.approx)
}
# Options: method.nn
if (!missing(method.nn)) {
opts <- c(opts, "-nn", method.nn)
}
# Options: method.GU
if (!missing(method.GU)) {
opts <- c(opts, "-GU", method.GU)
}
# Options: method.singleMM
if (!missing(method.singleMM)) {
opts <- c(opts, "-sinMM", method.singleMM)
}
# Options: method.tandemMM
if (!missing(method.tandemMM)) {
## Bug in -tan in MELTING 5 when "tur99" or "allsanpey"
if (method.tandemMM == "tur99" | method.tandemMM == "allsanpey") {
# method.tandemMM <- "tur06"
} else {
opts <- c(opts, "-tanMM", method.tandemMM)
}
}
# Options: method.single.dangle
if (!missing(method.single.dangle)) {
opts <- c(opts, "-sinDE", method.single.dangle)
}
# Options: method.double.dangle
if (!missing(method.double.dangle)) {
opts <- c(opts, "-secDE", method.double.dangle)
}
# Options: method.long.dangle
if (!missing(method.long.dangle)) {
opts <- c(opts, "-lonDE", method.long.dangle)
}
# Options: method.internal.loop
if (!missing(method.internal.loop)) {
opts <- c(opts, "-intLP", method.internal.loop)
}
# Options: method.single.bulge.loop
if (!missing(method.single.bulge.loop)) {
opts <- c(opts, "-sinBU", method.single.bulge.loop)
}
# Options: method.long.bulge.loop
if (!missing(method.long.bulge.loop)) {
opts <- c(opts, "-lonBU", method.long.bulge.loop)
}
# Options: method.CNG
if (!missing(method.CNG)) {
opts <- c(opts, "-CNG", method.CNG)
}
# Options: method.inosine
if (!missing(method.inosine)) {
opts <- c(opts, "-ino", method.inosine)
}
# Options: method.hydroxyadenine
if (!missing(method.hydroxyadenine)) {
opts <- c(opts, "-ha", method.hydroxyadenine)
}
# Options: method.azobenzenes
if (!missing(method.azobenzenes)) {
opts <- c(opts, "-azo", method.azobenzenes)
}
# Options: method.locked
if (!missing(method.locked)) {
opts <- c(opts, "-lck", method.locked)
}
# Options: correction.ion
if (!missing(correction.ion)) {
opts <- c(opts, "-ion", correction.ion)
}
# Options: method.Naeq
if (!missing(method.Naeq)) {
opts <- c(opts, "-naeq", method.Naeq)
}
# Options: correction.DMSO
if (!missing(correction.DMSO)) {
opts <- c(opts, "-DMSO", correction.DMSO)
}
# Options: correction.formamide
if (!missing(correction.formamide)) {
opts <- c(opts, "-for", correction.formamide)
}
# Add verbose
# opts <- c(opts, "-O", "test.txt")
# opts <- c(opts, "-v")
##################################################
# Get results
##################################################
meltj <- rJava::new(J("melting.Main"))
optionManager <- rJava::new(J("melting.configuration.OptionManagement"))
#results <- meltj$getMeltingResults(opts, optionManager)
# Check for error and/or warning(s) and Fetch result
pResults <- withWE(meltj$getMeltingResults(opts, optionManager))
# Check for error and/or warning(s) and Fetch environment
pEnv <- withWE(optionManager$createEnvironment(opts))
if (isS4(pEnv$value) && .jinstanceof(pEnv$value,
J("melting.Environment"))) {
# Get environment
env <- pEnv$value
envir_melt <- list(`Sequence` = env$getSequences()$getSequence(),
`Complementary sequence` = env$getSequences()$getComplementary(),
`Nucleic acid concentration (M)` = env$getNucleotides(),
`Hybridization type` = env$getHybridization(),
`Na concentration (M)` = env$getNa(),
`Mg concentration (M)` = env$getMg(),
`Tris concentration (M)` = env$getTris(),
`K concentration (M)` = env$getK(),
`dNTP concentration (M)` = env$getDNTP(),
`DMSO concentration (%)` = env$getDMSO(),
`Formamide concentration (M or %)` = env$getFormamide(),
`Self complementarity` = env$isSelfComplementarity(),
`Correction factor` = env$getFactor())
# Get options
opt_names <- c("-tan", "-P", "-S", "-T", "-DMSO", "-secDE", "-ino",
"-sinBU", "-lonDE", "-lck", "-self", "-am", "-sinDE",
"-azo", "-lonBU", "-naeq", "-intLP", "-ha", "-for", "-nn",
"-NNPath", "-C", "-E", "-F", "-sinMM", "-H", "-mode", "-GU",
"-CNG", "-ion")
opt_names <- setdiff(opt_names, "-NNPath")
opts_melt <- env$getOptions()
keySet <- .jrcall(opts_melt, "keySet")
opts_iter <- .jrcall(keySet, "iterator")
# opts_melt2 <- list()
opts_melt2 <- vector(length = length(opt_names), mode = "list")
names(opts_melt2) <- opt_names
while (.jrcall(opts_iter, "hasNext")) {
key <- .jrcall(opts_iter, "next")
opts_melt2[[key]] <- .jrcall(opts_melt, "get", key)
}
options_melt <- list(`Approximative formula` = opts_melt2$`-am`,
`Nearest neighbour model` = opts_melt2$`-nn`,
`GU model` = opts_melt2$`-GU`,
`Single mismatch model` = opts_melt2$`-sinMM`,
`Tandem mismatch model` = opts_melt2$`-tan`,
`Single dangling end model` = opts_melt2$`-sinDE`,
`Double dangling end model` = opts_melt2$`-secDE`,
`Long dangling end model` = opts_melt2$`-lonDE`,
`Internal loop model` = opts_melt2$`-intLP`,
`Single bulge loop model` = opts_melt2$`-sinBU`,
`Long bulge loop model` = opts_melt2$`-lonBU`,
`CNG repeats model` = opts_melt2$CNG,
`Inosine bases model` = opts_melt2$`-ino`,
`Hydroxyadenine bases model` = opts_melt2$`-ha`,
`Azobenzenes model` = opts_melt2$`-azo`,
`Locked nucleic acids model` = opts_melt2$`-lck`,
`Ion correction method` = opts_melt2$`-ion`,
`Na equivalence correction method` = opts_melt2$`-naeq`,
`DMSO correction method` = opts_melt2$`-DMSO`,
`Formamide correction method` = opts_melt2$`-for`,
Mode = opts_melt2$`-mode`)
} else {
envir_melt <- list(`Sequence` = NA,
`Complementary sequence` = NA,
`Nucleic acid concentration (M)` = NA,
`Hybridization type` = NA,
`Na concentration (M)` = NA,
`Mg concentration (M)` = NA,
`Tris concentration (M)` = NA,
`K concentration (M)` = NA,
`dNTP concentration (M)` = NA,
`DMSO concentration (%)` = NA,
`Formamide concentration (M or %)` = NA,
`Self complementarity` = NA,
`Correction factor` = NA)
options_melt <- list(`Approximative formula` = NA,
`Nearest neighbour model` = NA,
`GU model` = NA,
`Single mismatch model` = NA,
`Tandem mismatch model` = NA,
`Single dangling end model` = NA,
`Double dangling end model` = NA,
`Long dangling end model` = NA,
`Internal loop model` = NA,
`Single bulge loop model` = NA,
`Long bulge loop model` = NA,
`CNG repeats model` = NA,
`Inosine bases model` = NA,
`Hydroxyadenine bases model` = NA,
`Azobenzenes model` = NA,
`Locked nucleic acids model` = NA,
`Ion correction method` = NA,
`Na equivalence correction method` = NA,
`DMSO correction method` = NA,
`Formamide correction method` = NA,
Mode = NA)
}
# Get Results
if (isS4(pResults$value) && .jinstanceof(pResults$value,
J("melting.ThermoResult"))) {
results <- pResults$value
# Fetch calculation method
calculMethod <- results$getCalculMethod()
if (.jinstanceof(calculMethod,
J("melting.nearestNeighborModel.NearestNeighborMode"))) {
options_melt$`Approximative formula` <- NA_character_
} else {
options_melt$`Nearest neighbour model` <- NA_character_
}
# Fetch enthalpy and entropy for nearest-neighbour methods
if (.jinstanceof(calculMethod,
J("melting.nearestNeighborModel.NearestNeighborMode"))) {
enthalpy_cal <- results$getEnthalpy()
entropy_cal <- results$getEntropy()
enthalpy_J <- entropy_J <- NULL
enthalpy_J <- results$getEnergyValueInJ(enthalpy_cal)
entropy_J <- results$getEnergyValueInJ(entropy_cal)
} else {# NA for approximative methods
enthalpy_cal <- NA_integer_
entropy_cal <- NA_integer_
enthalpy_J <- NA_integer_
entropy_J <- NA_integer_
}
melting_temp_C <- results$getTm()
# Get melting results
results_melt <- list(`Enthalpy (cal)` = enthalpy_cal,
`Entropy (cal)` = entropy_cal,
`Enthalpy (J)` = enthalpy_J,
`Entropy (J)` = entropy_J,
`Melting temperature (C)` = melting_temp_C)
} else {
results_melt <- list(`Enthalpy (cal)` = NA,
`Entropy (cal)` = NA,
`Enthalpy (J)` = NA,
`Entropy (J)` = NA,
`Melting temperature (C)` = NA)
}
msg <- c(pEnv$message, pResults$message)
if(!all(is.na(msg))) {
msg <- paste(setdiff(msg, NA), collapse = "\n")
} else {
msg <- NA
}
out <- list(Environment = envir_melt,
Options = replace(options_melt,
vapply(options_melt, is.null,
logical(length = 1)),
NA_character_),
Results = results_melt,
Message = msg)
attr(out, "command") <- paste(opts, collapse = " ")
# Set Class
class(out) <- "melting"
return(out)
}
Try the rmelting package in your browser
Any scripts or data that you put into this service are public.
rmelting documentation built on Nov. 8, 2020, 5:19 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Defines functions melting
Documented in melting
#' Compute melting temperature of a nucleic acid duplex
#'
#' Compute the enthalpy and entropy of helix-coil transition, and then the
#' melting temperature of a nucleic acid duplex with the
#' \href{https://www.ebi.ac.uk/biomodels/tools/melting/}{MELTING 5 software} (Le
#' Novère, 2001; Dumousseau et al., 2012).
#'
#' @usage melting(sequence, comp.sequence = NULL,
#' nucleic.acid.conc,
#' hybridisation.type = c("dnadna", "rnarna", "dnarna",
#' "rnadna", "mrnarna", "rnamrna"),
#' Na.conc, Mg.conc, Tris.conc, K.conc,
#' dNTP.conc, DMSO.conc, formamide.conc,
#' size.threshold = 60, force.self = FALSE, correction.factor,
#' method.approx = c("ahs01", "che93", "che93corr",
#' "schdot", "owe69", "san98",
#' "wetdna91", "wetrna91", "wetdnarna91"),
#' method.nn = c("all97", "bre86", "san04", "san96", "sug96",
#' "tan04", "fre86", "xia98", "sug95", "tur06"),
#' method.GU = c("tur99", "ser12"),
#' method.singleMM = c("allsanpey", "tur06", "zno07", "zno08", "wat11"),
#' method.tandemMM = c("allsanpey", "tur99"),
#' method.single.dangle = c("bom00", "sugdna02", "sugrna02", "ser08"),
#' method.double.dangle = c("sugdna02", "sugrna02", "ser05", "ser06"),
#' method.long.dangle = c("sugdna02", "sugrna02"),
#' method.internal.loop = c("san04", "tur06", "zno07"),
#' method.single.bulge.loop = c("tan04", "san04", "ser07" ,"tur06"),
#' method.long.bulge.loop = c("san04", "tur06"),
#' method.CNG = c("bro05"),
#' method.inosine = c("san05", "zno07"),
#' method.hydroxyadenine = c("sug01"),
#' method.azobenzenes = c("asa05"),
#' method.locked = c("mct04"),
#' correction.ion = c("ahs01", "kam71", "marschdot",
#' "owc1904", "owc2004", "owc2104",
#' "owc2204", "san96", "san04", "schlif",
#' "tanna06", "tanna07", "wet91",
#' "owcmg08", "tanmg06", "tanmg07",
#' "owcmix08", "tanmix07"),
#' method.Naeq = c("ahs01", "mit96", "pey00"),
#' correction.DMSO = c("ahs01", "cul76", "esc80", "mus81"),
#' correction.formamide = c("bla96", "lincorr"))
#'
#' @section Mandatory arguments: The following are the arguments which are
#' mandatory for computation. \describe{ \item{\code{sequence}}{5' to 3'
#' sequence of one strand of the nucleic acid duplex as a character string.
#' Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL. U and T are
#' not considered identical (see \strong{Recognized nucleotides}).}
#' \item{\code{comp.sequence}}{Mandatory if there are mismatches, inosine(s)
#' or hydroxyadenine(s) between the two strands. If not specified, it is
#' computed as the complement of \code{sequence}. Self-complementarity in
#' \code{sequence} is detected even though there may be (are) dangling end(s)
#' and \code{comp.sequence} is computed (see \strong{Self complementary
#' sequences}).} \item{\code{nucleic.acid.conc}}{See \strong{Correction factor
#' for nucleic acid concentration.}} \item{\code{Na.conc, Mg.conc, Tris.conc,
#' K.conc}}{At least one cation (Na, Mg, Tris, K) concentration is mandatory,
#' the other agents(dNTP, DMSO, formamide) are optional (see \strong{Ion and
#' agent concentrations}).} \item{\code{hybridisation.type}}{See
#' \strong{Hybridisation type options.}} }
#'
#' @section Recognized nucleotides: \tabular{ll}{ \strong{Code} \tab
#' \strong{Type} \cr A \tab Adenine \cr C \tab Cytosine \cr G \tab Guanine \cr
#' T \tab Thymine \cr U \tab Uracil \cr I \tab Inosine \cr X_C \tab Trans
#' azobenzenes \cr X_T \tab Cis azobenzenes \cr A* \tab Hydroxyadenine \cr AL
#' \tab Locked nucleic acid\cr TL \tab " \cr GL \tab " \cr CL \tab " }
#'
#' U and T are not considered identical.
#'
#' @section Hybridisation type options: The details of the possible options for
#' hybridisation type specified in the argument \code{hybridisation.type} are
#' as follows:
#'
#' \tabular{lll}{ \strong{Option} \tab \strong{\code{Sequence}} \tab
#' \strong{\code{Complementary sequence}}\cr \code{dnadna} \tab DNA \tab DNA
#' \cr \code{rnarna} \tab RNA \tab RNA \cr \code{dnarna} \tab DNA \tab RNA \cr
#' \code{rnadna} \tab RNA \tab DNA \cr \code{mrnarna} \tab 2-o-methyl RNA \tab
#' RNA \cr \code{rnamrna} \tab RNA \tab 2-o-methyl RNA }
#'
#' This parameter determines the nature of the sequences in the arguments
#' \code{sequence} and \code{comp.sequence}.
#'
#' @section Ion and agent concentrations: Ion concentrations are specified by
#' the arguments \code{Na.conc}, \code{Mg.conc}, \code{Tris.conc} and
#' \code{K.conc}, while agent concentrations are specified by the arguments
#' \code{dNTP.conc}, \code{DMSO.conc} and \code{formamide.conc}.
#'
#' These values are used for different correction functions which
#' approximately adjusts for effects of these ions (Na, Mg, Tris, K) and/or
#' agents (dNTP, DMSO, formamide) on on thermodynamic stability of nucleic
#' acid duplexes. Their concentration limits depends on the correction method
#' used. All the concentrations must be in M, except for the DMSO (\%) and
#' formamide (\% or M depending on the correction method). Note that
#' \ifelse{html}{\out{[Tris<sup>+</sup>]}}{\eqn{[\textnormal{Tris}^{+}]}} is
#' about half of the total tris buffer concentration.
#'
#' @section Self complementary sequences: Self complementarity for perfect
#' matching sequences or sequences with dangling ends is detected
#' automatically. However it can be enforced by the argument \code{force.self
#' = TRUE}.
#'
#' @section Correction factor for nucleic acid concentration: For self
#' complementary sequences (Auto detected or specified by \code{force.self})
#' it is 1. Otherwise it is 4 if the both strands are present in equivalent
#' amount and 1 if one strand is in excess.
#'
#' @section Approximative estimation formulas: \tabular{llll}{
#' \strong{Formula}\tab \strong{Type} \tab \strong{Limits/Remarks}\tab
#' \strong{Reference}\cr \code{ahs01}\tab DNA\tab No mismatch \tab von Ahsen
#' et al., 2001 \cr \code{che93}\tab DNA\tab No mismatch; Na=0, Mg=0.0015,
#' \tab Marmur and Doty, 1962\cr \tab \tab Tris=0.01, K=0.05 \tab \cr
#' \code{che93corr}\tab DNA\tab No mismatch; Na=0, Mg=0.0015, \tab Marmur and
#' Doty, 1962\cr \tab \tab Tris=0.01, K=0.05 \tab \cr \code{schdot}\tab
#' DNA\tab No mismatch \tab Wetmur, 1991; Marmur and \cr \tab \tab \tab Doty,
#' 1962; Chester and\cr \tab \tab \tab Marshak, 1993; Schildkraut \cr \tab
#' \tab \tab and Lifson, 1965; Wahl et\cr \tab \tab \tab al., 1987; Britten et
#' al., \cr \tab \tab \tab 1974; Hall et al., 1980\cr \code{owe69}\tab DNA\tab
#' No mismatch \tab Owen et al., 1969; \cr \tab \tab \tab Frank-Kamenetskii,
#' 1971; \cr \tab \tab \tab Blake, 1996; Blake and \cr \tab \tab \tab
#' Delcourt, 1998 \cr \code{san98}\tab DNA\tab No mismatch \tab SantaLucia,
#' 1998; von Ahsen\cr \tab \tab \tab et al., 2001 \cr \code{wetdna91}*\tab
#' DNA\tab \tab Wetmur, 1991 \cr \code{wetrna91}*\tab RNA\tab \tab Wetmur,
#' 1991 \cr \code{wetdnarna91}* \tab DNA/RNA\tab \tab Wetmur, 1991 } * Default
#' formula for computation.
#'
#' Note that calculation is increasingly incorrect when the length of the
#' duplex decreases. Further, it does not take into account nucleic acid
#' concentration.
#'
#' @section Nearest neighbor models:
#'
#' \subsection{Perfectly matching sequences}{\tabular{llll}{ \strong{Model}
#' \tab \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference}\cr
#' \code{all97}*\tab DNA\tab \tab Allawi and SantaLucia, 1997\cr
#' \code{tur06}*\tab 2'-O-MeRNA/\tab A sodium correction\tab Kierzek et al.,
#' 2006 \cr \tab RNA\tab (\code{san04}) is \tab \cr \tab \tab automatically
#' applied to \tab \cr \tab \tab convert the entropy (Na =\tab \cr \tab \tab
#' 0.1M) into the entropy (Na = \tab \cr \tab \tab 1M). \tab \cr \code{bre86}
#' \tab DNA\tab \tab Breslauer et al., 1986 \cr \code{san04} \tab DNA\tab \tab
#' SantaLucia and Hicks, 2004 \cr \code{san96} \tab DNA\tab \tab SantaLucia et
#' al., 1996\cr \code{sug96} \tab DNA\tab \tab Sugimoto et al., 1996\cr
#' \code{tan04} \tab DNA\tab \tab Tanaka et al., 2004\cr \code{fre86} \tab
#' RNA\tab \tab Freier et al., 1986\cr \code{xia98}*\tab RNA\tab \tab Xia et
#' al., 1998 \cr \code{sug95}*\tab DNA/ \tab \tab SantaLucia et al., 1996\cr
#' \tab RNA\tab \tab } * Default model for computation.}
#'
#' \subsection{GU wobble base pairs effect}{\tabular{llll}{ \strong{Model}
#' \tab \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference} \cr
#' \code{tur99} \tab RNA\tab \tab Mathews et al., 1999 \cr \code{ser12}* \tab
#' RNA\tab \tab Chen et al., 2012 } * Default model for computation.
#'
#' GU base pairs are not taken into account by the approximative mode.}
#'
#' \subsection{Single mismatch effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{allsanpey}* \tab DNA \tab \tab Allawi and SantaLucia, 1997;\cr \tab
#' \tab \tab Allawi and SantaLucia, 1998;\cr \tab \tab \tab Allawi and
#' SantaLucia, 1998;\cr \tab \tab \tab Allawi and SantaLucia, 1998;\cr \tab
#' \tab \tab Peyret et al., 1999 \cr \code{wat11}* \tab DNA/RNA \tab \tab
#' Watkins et al., 2011 \cr \code{tur06} \tab RNA \tab \tab Lu et al., 2006
#' \cr \code{zno07}* \tab RNA \tab \tab Davis and Znosko, 2007 \cr
#' \code{zno08} \tab RNA \tab At least one adjacent GU base \tab Davis and
#' Znosko, 2008 \cr \tab \tab pair. \tab } * Default model for computation.
#'
#' Single mismatches are not taken into account by the approximative mode.}
#'
#' \subsection{Tandem mismatches effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{allsanpey}* \tab DNA \tab Only GT mismatches and TA/TG \tab Allawi
#' and SantaLucia, 1997;\cr \tab \tab mismatches. \tab Allawi and SantaLucia,
#' 1998;\cr \tab \tab \tab Allawi and SantaLucia, 1998;\cr \tab \tab \tab
#' Allawi and SantaLucia, 1998;\cr \tab \tab \tab Peyret et al., 1999 \cr
#' \code{tur99}* \tab RNA \tab No adjacent GU or UG base \tab Mathews et al.,
#' 1999; Lu et \cr \tab \tab pairs. \tab al., 2006 } * Default model for
#' computation.
#'
#' Tandem mismatches are not taken into account by the approximative mode.
#' Note that not all the mismatched Crick's pairs have been investigated.}
#'
#' \subsection{Single dangling end effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{bom00}* \tab DNA \tab \tab Bommarito et al., 2000 \cr \code{sugdna02}
#' \tab DNA \tab Only terminal poly A self \tab Ohmichi et al., 2002 \cr \tab
#' \tab complementary sequences. \tab \cr \code{sugrna02} \tab RNA \tab Only
#' terminal poly A self \tab Ohmichi et al., 2002 \cr \tab \tab complementary
#' sequences. \tab \cr \code{ser08}* \tab RNA \tab Only 3' UA, GU and UG \tab
#' O'Toole et al., 2006; Miller\cr \tab \tab terminal base pairs only 5' \tab
#' et al., 2008 \cr \tab \tab UG and GU terminal base \tab \cr \tab \tab
#' pairs. \tab } * Default model for computation.
#'
#' Single dangling ends are not taken into account by the approximative mode.}
#'
#' \subsection{Double dangling end effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference} \cr
#' \code{sugdna02}* \tab DNA\tab Only terminal poly A self\tab Ohmichi et al.,
#' 2002\cr \tab \tab complementary sequences. \tab \cr \code{sugrna02}\tab
#' RNA\tab Only terminal poly A self\tab Ohmichi et al., 2002\cr \tab \tab
#' complementary sequences. \tab \cr \code{ser05} \tab RNA\tab Depends on the
#' available \tab O'Toole et al., 2005\cr \tab \tab thermodynamic parameters
#' for \tab \cr \tab \tab single dangling end. \tab \cr \code{ser06}*\tab
#' RNA\tab \tab O'Toole et al., 2006 } * Default model for computation.
#'
#' Double dangling ends are not taken into account by the approximative mode.}
#'
#' \subsection{Long dangling end effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference} \cr
#' \code{sugdna02}* \tab DNA\tab Only terminal poly A self \tab Ohmichi et
#' al., 2002\cr \tab \tab complementary sequences.\tab \cr \code{sugrna02}*
#' \tab RNA\tab Only terminal poly A self \tab Ohmichi et al., 2002\cr \tab
#' \tab complementary sequences.\tab } * Default model for computation.
#'
#' Long dangling ends are not taken into account by the approximative mode.}
#'
#' \subsection{Internal loop effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{san04}* \tab DNA \tab Missing asymmetry penalty. \tab SantaLucia and
#' Hicks, 2004\cr \tab \tab Not tested with experimental \tab \cr \tab \tab
#' results. \tab \cr \code{tur06} \tab RNA \tab Not tested with experimental
#' \tab Lu et al., 2006 \cr \tab \tab results. \tab \cr \code{zno07}* \tab RNA
#' \tab Only for 1x2 loop. \tab Badhwar et al., 2007 } * Default model for
#' computation.
#'
#' Internal loops are not taken into account by the approximative mode.}
#'
#' \subsection{Single bulge loop effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference} \cr
#' \code{tan04}*\tab DNA\tab \tab Tan and Chen, 2007\cr \code{san04} \tab
#' DNA\tab Missing closing AT penalty. \tab SantaLucia and Hicks, 2004\cr
#' \code{ser07} \tab RNA\tab Less reliable results. Some \tab Blose et al.,
#' 2007\cr \tab \tab missing parameters. \tab \cr \code{tur06}*\tab RNA\tab
#' \tab Lu et al., 2006 } * Default model for computation.
#'
#' Single bulge loops are not taken into account by the approximative mode.}
#'
#' \subsection{Long bulge loop effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{san04}* \tab DNA \tab Missing closing AT penalty. \tab SantaLucia and
#' Hicks, 2004 \cr \code{tur06}* \tab RNA \tab Not tested with experimental
#' \tab Mathews et al., 1999; Lu et\cr \tab \tab results. \tab al., 2006 } *
#' Default model for computation.
#'
#' Long bulge loops are not taken into account by the approximative mode.}
#'
#' \subsection{CNG repeats effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference}\cr
#' \code{bro05}*\tab RNA\tab Self complementary sequences. \tab Broda et al.,
#' 2005 \cr \tab \tab 2 to 7 CNG repeats. \tab } * Default model for
#' computation.
#'
#' CNG repeats are not taken into account by the approximative mode. The
#' contribution of CNG repeats to the thermodynamic of helix-coil transition
#' can be computed only for 2 to 7 CNG repeats. N represents a single mismatch
#' of type N/N.}
#'
#' \subsection{Inosine bases effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference} \cr
#' \code{san05}*\tab DNA\tab Missing parameters for tandem \tab Watkins and
#' SantaLucia, 2005\cr \tab \tab base pairs containing inosine \tab \cr \tab
#' \tab bases.\tab \cr \code{zno07}*\tab RNA\tab Only IU base pairs. \tab
#' Wright et al., 2007 } * Default model for computation.
#'
#' Inosine bases (I) are not taken into account by the approximative mode.}
#'
#' \subsection{Hydroxyadenine bases effect}{\tabular{llll}{ \strong{Model}
#' \tab \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference}\cr
#' \code{sug01}*\tab DNA\tab Only 5' GA*C 3'and 5' TA*A 3' \tab Kawakami et
#' al., 2001\cr \tab \tab contexts. \tab } * Default model for computation.
#'
#' Hydroxyadenine bases (A*) are not taken into account by the approximative
#' mode.}
#'
#' \subsection{Azobenzenes effect effect}{\tabular{llll}{ \strong{Model} \tab
#' \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference} \cr
#' \code{asa05}*\tab DNA\tab Less reliable results when \tab Asanuma et al.,
#' 2005\cr \tab \tab the number of cis azobenzene \tab \cr \tab \tab
#' increases. \tab } * Default model for computation.
#'
#' Azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) are not
#' taken into account by the approximative mode.}
#'
#' \subsection{Locked nucleic acids effect}{\tabular{llll}{ \strong{Model}
#' \tab \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference} \cr
#' \code{mct04}* \tab DNA \tab \tab McTigue et al., 2004 } * Default model for
#' computation.
#'
#' Locked nucleic acids (AL, GL, TL and CL) are not taken into account by the
#' approximative mode.}
#'
#' @section Ion corrections:
#'
#' \subsection{Sodium corrections}{\tabular{llll}{ \strong{Correction} \tab
#' \strong{Type} \tab \strong{Limits.Remarks} \tab \strong{Reference} \cr
#' \code{ahs01} \tab DNA \tab Na>0. \tab von Ahsen et al., 2001 \cr
#' \code{schlif} \tab DNA \tab Na>=0.07; Na<=0.12. \tab Schildkraut and
#' Lifson, 1965\cr \code{tanna06} \tab DNA \tab Na>=0.001; Na<=1. \tab Tan and
#' Chen, 2006 \cr \code{tanna07}* \tab RNA \tab Na>=0.003; Na<=1. \tab Tan and
#' Chen, 2007 \cr \tab or \tab \tab \cr \tab 2'-O-MeRNA/RNA \tab \tab \cr
#' \code{wet91} \tab RNA, \tab Na>0. \tab Wetmur, 1991 \cr \tab DNA \tab \tab
#' \cr \tab and \tab \tab \cr \tab RNA/DNA \tab \tab \cr \code{kam71} \tab DNA
#' \tab Na>0; Na>=0.069; Na<=1.02. \tab Frank-Kamenetskii, 1971 \cr
#' \code{marschdot} \tab DNA \tab Na>=0.069; Na<=1.02. \tab Marmur and Doty,
#' 1962; Blake\cr \tab \tab \tab and Delcourt, 1998 \cr \code{owc1904} \tab
#' DNA \tab Na>0. (equation 19) \tab Owczarzy et al., 2004 \cr \code{owc2004}
#' \tab DNA \tab Na>0. (equation 20) \tab Owczarzy et al., 2004 \cr
#' \code{owc2104} \tab DNA \tab Na>0. (equation 21) \tab Owczarzy et al., 2004
#' \cr \code{owc2204}* \tab DNA \tab Na>0. (equation 22) \tab Owczarzy et al.,
#' 2004 \cr \code{san96} \tab DNA \tab Na>=0.1. \tab SantaLucia et al., 1996
#' \cr \code{san04} \tab DNA \tab Na>=0.05; Na<=1.1; \tab SantaLucia and
#' Hicks, 2004; \cr \tab \tab Oligonucleotides inferior to \tab SantaLucia,
#' 1998 \cr \tab \tab 16 bases. \tab }} * Default correction method for
#' computation.
#'
#' \subsection{Magnesium corrections}{\tabular{llll}{ \strong{Correction} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference}\cr
#' \code{owcmg08}*\tab DNA\tab Mg>=0.0005; Mg<=0.6.\tab Owczarzy et al.,
#' 2008\cr \code{tanmg06} \tab DNA\tab Mg>=0.0001; Mg<=1; Oligomer \tab Tan
#' and Chen, 2006 \cr \tab \tab length superior to 6 base \tab \cr \tab \tab
#' pairs.\tab \cr \code{tanmg07}*\tab RNA\tab Mg>=0.1; Mg<=0.3. \tab Tan and
#' Chen, 2007 }} * Default correction method for computation.
#'
#' \subsection{Mixed Sodium and Magnesium corrections}{\tabular{llll}{
#' \strong{Correction} \tab \strong{Type} \tab \strong{Limits.Remarks} \tab
#' \strong{Reference} \cr \code{owcmix08}* \tab DNA \tab Mg>=0.0005; Mg<=0.6;
#' \tab Owczarzy et al., 2008\cr \tab \tab Na+K+Tris/2>0. \tab \cr
#' \code{tanmix07} \tab DNA, \tab Mg>=0.1; Mg<=0.3; \tab Tan and Chen, 2007
#' \cr \tab RNA \tab Na+K+Tris/2>=0.1; \tab \cr \tab or \tab Na+K+Tris/2<=0.3.
#' \tab \cr \tab 2'-O-MeRNA/RNA \tab \tab }} * Default correction method for
#' computation.
#'
#' The ion correction by Owczarzy et al. (2008) is used by default according
#' to the \ifelse{html}{\out{[Mg<sup>2+</sup>]<sup>0.5</sup> ⁄
#' [Mon<sup>+</sup>]}}{\eqn{\frac{[\textnormal{Mg}^{2+}]^{0.5}}{[\textnormal{Mon}^{+}]}}}
#' ratio, where \ifelse{html}{\out{[Mon<sup>+</sup>] = [Na<sup>+</sup>]
#' + [Tris<sup>+</sup>] + [K<sup>+</sup>]
#' }}{\eqn{[\textnormal{Mon}^{+}] =
#' [\textnormal{Na}^{+}]+[\textnormal{Tris}^{+}]+[\textnormal{K}^{+}]}}.
#'
#' If, \describe{
#' \item{\ifelse{html}{\out{[Mon<sup>+</sup>]}}{\eqn{[\textnormal{Mon}^{+}]}}
#' = 0}{Default sodium correction is used.} \item{Ratio < 0.22,}{Default
#' sodium correction is used.} \item{0.22 <= Ratio < 6}{Default mixed Na and
#' Mg correction is used.} \item{Ratio >= 6}{Default magnesium correction is
#' used.} }
#'
#' Note that
#' \ifelse{html}{\out{[Tris<sup>+</sup>]}}{\eqn{[\textnormal{Tris}^{+}]}} is
#' about half of the total tris buffer concentration.
#'
#' \subsection{Sodium equivalent concentration methods}{\tabular{llll}{
#' \strong{Correction} \tab \strong{Type} \tab \strong{Limits/Remarks} \tab
#' \strong{Reference} \cr \code{ahs01}*\tab DNA\tab \tab von Ahsen et al.,
#' 2001\cr \code{mit96} \tab DNA\tab \tab Mitsuhashi, 1996\cr \code{pey00}
#' \tab DNA\tab \tab Peyret, 2000 } * Default correction method for
#' computation.
#'
#' For the other types of hybridization, the DNA default correction is used.
#' If there are other cations when an approximative approach is used, a sodium
#' equivalence is automatically computed. In case of nearest neighbor
#' approach, the sodium equivalence will be used only if a sodium correction
#' is specified by the argument \code{correction.ion}.}
#'
#' @section Denaturing agent corrections:
#'
#' \subsection{DMSO corrections}{\tabular{llll}{ \strong{Correction} \tab
#' \strong{Type} \tab \strong{Limits/Remarks} \tab \strong{Reference}\cr
#' \code{ahs01*} \tab DNA\tab Not tested with experimental \tab von Ahsen et
#' al., 2001 \cr \tab \tab results. \tab \cr \code{cul76} \tab DNA\tab Not
#' tested with experimental \tab Cullen and Bick, 1976\cr \tab \tab results.
#' \tab \cr \code{esc80} \tab DNA\tab Not tested with experimental \tab Escara
#' and Hutton, 1980\cr \tab \tab results. \tab \cr \code{mus81} \tab DNA\tab
#' Not tested with experimental \tab Musielski et al., 1981 \cr \tab \tab
#' results. \tab } * Default correction method for computation.
#'
#' For the other types of hybridization, the DNA default correction is used.
#' If there is DMSO when an approximative approach is used, a DMSO correction
#' is automatically computed. In case of nearest neighbor approach and
#' approximative approach, the DMSO correction will be used only if a sodium
#' correction is specified by the argument \code{correction.ion}.}
#'
#' \subsection{Formamide corrections}{\tabular{llll}{ \strong{Correction} \tab
#' \strong{Type} \tab \strong{Limits/Remarks}\tab \strong{Reference} \cr
#' \code{bla96*} \tab DNA\tab With formamide concentration\tab Blake, 1996 \cr
#' \tab \tab in mol/L. \tab \cr \code{lincorr} \tab DNA\tab With a % of
#' formamide volume. \tab McConaughy et al., 1969;\cr \tab \tab \tab Record,
#' 1967; Casey and \cr \tab \tab \tab Davidson, 1977; Hutton, 1977 } * Default
#' correction method for computation.
#'
#' For the other types of hybridization, the DNA default correction is used.
#' If there is formamide when an approximative approach is used, a formamide
#' correction is automatically computed. In case of nearest neighbor approach
#' and approximative approach, the formamide correction will be used only if a
#' sodium correction is specified by the argument \code{correction.ion}.}
#'
#' @param sequence Sequence (5' to 3') of one strand of the nucleic acid duplex
#' as a character string (\strong{Note:} Uridine and thymidine are not
#' considered as identical).
#' @param comp.sequence Complementary sequence (3' to 5') of the nucleic acid
#' duplex as a character string.
#' @param nucleic.acid.conc Concentration of the nucleic acid strand (M or
#' \ifelse{html}{\out{mol L<sup>-1</sup>}}{\eqn{\textrm{mol L}^{-1}}}) in
#' excess as a numeric value.
#' @param hybridisation.type The hybridisation type. Either \code{"dnadna"},
#' \code{"rnarna"}, \code{"dnarna"}, \code{"rnadna"}, \code{"mrnarna"} or
#' \code{"rnamrna"} (see \strong{Hybridisation type options}).
#' @param Na.conc Concentration of Na ions (M) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param Mg.conc Concentration of Mg ions (M) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param Tris.conc Concentration of Tris ions (M) as a positive numeric value
#' (see \strong{Ion and agent concentrations}).
#' @param K.conc Concentration of K ions (M) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param dNTP.conc Concentration of dNTP (M) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param DMSO.conc Concentration of DMSO (\%) as a positive numeric value (see
#' \strong{Ion and agent concentrations}).
#' @param formamide.conc Concentration of formamide (M or \% depending on
#' correction method) as a positive numeric value (see \strong{Ion and agent
#' concentrations}).
#' @param size.threshold Sequence length threshold to decide approximative or
#' nearest-neighbour approach for computation. Default is 60.
#' @param force.self logical. Enforces that \code{sequence} is self
#' complementary and \code{complementary sequence} is not required (seed
#' \strong{Self complementary sequences}). Default is \code{FALSE}.
#' @param correction.factor Correction factor to be used to modulate the effect
#' of the nucleic acid concentration (\code{nucleic.acid.conc}) in the
#' computation of melting temperature (see \strong{Correction factor for
#' nucleic acid concentration}).
#' @param method.approx Specify the approximative formula to be used for melting
#' temperature calculation for sequences of length greater than
#' \code{size.threshold}. Either \code{"ahs01"}, \code{"che93"},
#' \code{"che93corr"}, \code{"schdot"}, \code{"owe69"}, \code{"san98"},
#' \code{"wetdna91"}, \code{"wetrna91"} or \code{"wetdnarna91"} (see
#' \strong{Approximative formulas}).
#' @param method.nn Specify the nearest neighbor model to be used for melting
#' temperature calculation for perfectly matching sequences of length lesser
#' than \code{size.threshold}. Either \code{"all97"}, \code{"bre86"},
#' \code{"san04"}, \code{"san96"}, \code{"sug96"}, \code{"tan04"},
#' \code{"fre86"}, \code{"xia98"}, \code{"sug95"} or \code{"tur06"} (see
#' \strong{Perfectly matching sequences}).
#' @param method.GU Specify the nearest neighbor model to compute the
#' contribution of GU base pairs to the thermodynamic of helix-coil
#' transition. Either \code{"tur99"} or \code{"ser12"} (see \strong{GU wobble
#' base pairs effect}).
#' @param method.singleMM Specify the nearest neighbor model to compute the
#' contribution of single mismatch to the thermodynamic of helix-coil
#' transition. Either \code{"allsanpey"}, \code{"tur06"}, \code{"zno07"}
#' \code{"zno08"} or \code{"wat11"} (see \strong{Single mismatch effect}).
#' @param method.tandemMM Specify the nearest neighbor model to compute the
#' contribution of tandem mismatches to the thermodynamic of helix-coil
#' transition. Either \code{"allsanpey"} or \code{"tur99"} (see \strong{Tandem
#' mismatches effect}).
#' @param method.single.dangle Specify the nearest neighbor model to compute the
#' contribution of single dangling end to the thermodynamic of helix-coil
#' transition. Either \code{"bom00"}, \code{"sugdna02"}, \code{"sugrna02"} or
#' \code{"ser08"} (see \strong{Single dangling end effect}).
#' @param method.double.dangle Specify the nearest neighbor model to compute the
#' contribution of double dangling end to the thermodynamic of helix-coil
#' transition. Either \code{"sugdna02"}, \code{"sugrna02"}, \code{"ser05"} or
#' \code{"ser06"} (see \strong{Double dangling end effect}).
#' @param method.long.dangle Specify the nearest neighbor model to compute the
#' contribution of long dangling end to the thermodynamic of helix-coil
#' transition. Either \code{"sugdna02"} or \code{"sugrna02"} (see \strong{Long
#' dangling end effect}).
#' @param method.internal.loop Specify the nearest neighbor model to compute the
#' contribution of internal loop to the thermodynamic of helix-coil
#' transition. Either \code{"san04"}, \code{"tur06"} or \code{"zno07"} (see
#' \strong{Internal loop effect}).
#' @param method.single.bulge.loop Specify the nearest neighbor model to compute
#' the contribution of single bulge loop to the thermodynamic of helix-coil
#' transition. Either \code{"san04"}, \code{"tan04"}, \code{"ser07"} or
#' \code{"tur06"} (see \strong{Single bulge loop effect}).
#' @param method.long.bulge.loop Specify the nearest neighbor model to compute
#' the contribution of long bulge loop to the thermodynamic of helix-coil
#' transition. Either \code{"san04"} or \code{"tur06"} (see \strong{Long bulge
#' loop effect}).
#' @param method.CNG Specify the nearest neighbor model to compute the
#' contribution of CNG repeats to the thermodynamic of helix-coil transition.
#' Available method is \code{"bro05"} (see \strong{CNG repeats effect}).
#' @param method.inosine Specify the specific nearest neighbor model to compute
#' the contribution of inosine bases (I) to the thermodynamic of helix-coil
#' transition. Either \code{"san05"} or \code{"zno07"} (see \strong{Inosine
#' bases effect}).
#' @param method.hydroxyadenine Specify the nearest neighbor model to compute
#' the contribution of hydroxyadenine bases (A*) to the thermodynamic of
#' helix-coil transition. Available method is \code{"sug01"} (see
#' \strong{Hydroxyadenine bases effect}).
#' @param method.azobenzenes Specify the nearest neighbor model to compute the
#' contribution of azobenzenes (X_T for trans azobenzenes and X_C for cis
#' azobenzenes) to the thermodynamic of helix-coil transition. Available
#' method is \code{"asa05"} (see \strong{Azobenzenes effect}).
#' @param method.locked Specify the nearest neighbor model to compute the
#' contribution of locked nucleic acids (AL, GL, TL and CL) to the
#' thermodynamic of helix-coil transition. Available method is \code{"mct04"}
#' (see \strong{Locked nucleic acids effect}).
#' @param correction.ion Specify the correction method for ions. Either one of
#' the following: \itemize{\item{Na corrections}{\code{"ahs01"},
#' \code{"kam71"}, \code{"owc1904"}, \code{"owc2004"}, \code{"owc2104"},
#' \code{"owc2204"}, \code{"san96"}, \code{"san04"}, \code{"schlif"},
#' \code{"tanna06"}, \code{"wetdna91"}, \code{"tanna07"}, \code{"wetrna91"} or
#' \code{"wetdnarna91"} (see \strong{Sodium corrections})} \item{Mg
#' corrections}{\code{"owcmg08"}, \code{"tanmg06"} or \code{"tanmg07"} (see
#' \strong{Magnesium corrections})} \item{Mixed Na Mg
#' corrections}{\code{"owcmix08"}, \code{"tanmix07"} or \code{"tanmix07"} (see
#' \strong{Mixed Sodium and Magnesium corrections})} }.
#' @param method.Naeq Specify the ion correction which gives a sodium equivalent
#' concentration if other cations are present. Either \code{"ahs01"},
#' \code{"mit96"} or \code{"pey00"} (see \strong{Sodium equivalent
#' concentration methods}).
#' @param correction.DMSO Specify the correction method for DMSO. Specify the
#' correction method for DMSO. Either \code{"ahs01"}, \code{"mus81"},
#' \code{"cul76"} or \code{"esc80"} (see \strong{DMSO corrections}).
#' @param correction.formamide Specify the correction method for formamide.
#' Specify the correction method for formamide Either \code{"bla96"} or
#' \code{"lincorr"} (see \strong{Formamide corrections}).
#'
#' @return A list with the following components: \item{\code{Environment}}{A
#' list with details about the melting temperature computation environment.}
#' \item{\code{Options}}{A list with details about the options (default or
#' user specified) used for melting temperature computation.}
#' \item{\code{Results}}{A list with the results of the melting temperature
#' computation including the enthalpy and entropy in case of nearest neighbour
#' methods.} \item{\code{Message}}{Error and/or Warning messages, if any.}
#'
#' @export
#' @import rJava
#' @importFrom Rdpack reprompt
#' @encoding UTF-8
#'
#' @references
#'
#' \insertRef{marmur_determination_1962}{rmelting}
#'
#' \insertRef{schildkraut_dependence_1965}{rmelting}
#'
#' \insertRef{record_electrostatic_1967}{rmelting}
#'
#' \insertRef{mcconaughy_nucleic_1969}{rmelting}
#'
#' \insertRef{owen_determination_1969}{rmelting}
#'
#' \insertRef{frank-kamenetskii_simplification_1971}{rmelting}
#'
#' \insertRef{britten_analysis_1974}{rmelting}
#'
#' \insertRef{cullen_thermal_1976}{rmelting}
#'
#' \insertRef{hutton_renaturation_1977}{rmelting}
#'
#' \insertRef{casey_rates_1977}{rmelting}
#'
#' \insertRef{hall_evolution_1980}{rmelting}
#'
#' \insertRef{escara_thermal_1980}{rmelting}
#'
#' \insertRef{musielski_influence_1981}{rmelting}
#'
#' \insertRef{freier_improved_1986}{rmelting}
#'
#' \insertRef{breslauer_predicting_1986}{rmelting}
#'
#' \insertRef{wahl_molecular_1987}{rmelting}
#'
#' \insertRef{wetmur_dna_1991}{rmelting}
#'
#' \insertRef{chester_dimethyl_1993}{rmelting}
#'
#' \insertRef{sugimoto_rna/dna_1994}{rmelting}
#'
#' \insertRef{sugimoto_thermodynamic_1995}{rmelting}
#'
#' \insertRef{santalucia_improved_1996}{rmelting}
#'
#' \insertRef{sugimoto_improved_1996}{rmelting}
#'
#' \insertRef{blake_thermodynamic_1996}{rmelting}
#'
#' \insertRef{blake_denaturation_1996}{rmelting}
#'
#' \insertRef{mitsuhashi_technical_1996}{rmelting}
#'
#' \insertRef{allawi_thermodynamics_1997}{rmelting}
#'
#' \insertRef{santalucia_unified_1998}{rmelting}
#'
#' \insertRef{xia_thermodynamic_1998}{rmelting}
#'
#' \insertRef{allawi_thermodynamics_1998}{rmelting}
#'
#' \insertRef{blake_thermal_1998}{rmelting}
#'
#' \insertRef{allawi_nearest_1998}{rmelting}
#'
#' \insertRef{allawi_nearest-neighbor_1998}{rmelting}
#'
#' \insertRef{mathews_expanded_1999}{rmelting}
#'
#' \insertRef{peyret_nearest-neighbor_1999}{rmelting}
#'
#' \insertRef{peyret_prediction_2000}{rmelting}
#'
#' \insertRef{bommarito_thermodynamic_2000}{rmelting}
#'
#' \insertRef{kawakami_thermodynamic_2001}{rmelting}
#'
#' \insertRef{von_ahsen_oligonucleotide_2001}{rmelting}
#'
#' \insertRef{le_novere_melting_2001}{rmelting}
#'
#' \insertRef{ohmichi_long_2002}{rmelting}
#'
#' \insertRef{santalucia_thermodynamics_2004}{rmelting}
#'
#' \insertRef{tanaka_thermodynamic_2004}{rmelting}
#'
#' \insertRef{mctigue_sequence-dependent_2004}{rmelting}
#'
#' \insertRef{owczarzy_effects_2004}{rmelting}
#'
#' \insertRef{broda_thermodynamic_2005}{rmelting}
#'
#' \insertRef{watkins_nearest-neighbor_2005}{rmelting}
#'
#' \insertRef{asanuma_clear-cut_2005}{rmelting}
#'
#' \insertRef{otoole_stability_2005}{rmelting}
#'
#' \insertRef{lu_set_2006}{rmelting}
#'
#' \insertRef{kierzek_nearest_2006}{rmelting}
#'
#' \insertRef{tan_nucleic_2006}{rmelting}
#'
#' \insertRef{otoole_comprehensive_2006}{rmelting}
#'
#' \insertRef{tan_rna_2007}{rmelting}
#'
#' \insertRef{wright_nearest_2007}{rmelting}
#'
#' \insertRef{davis_thermodynamic_2007}{rmelting}
#'
#' \insertRef{blose_non-nearest-neighbor_2007}{rmelting}
#'
#' \insertRef{badhwar_thermodynamic_2007}{rmelting}
#'
#' \insertRef{davis_thermodynamic_2008}{rmelting}
#'
#' \insertRef{miller_thermodynamic_2008}{rmelting}
#'
#' \insertRef{owczarzy_predicting_2008}{rmelting}
#'
#' \insertRef{watkins_thermodynamic_2011}{rmelting}
#'
#' \insertRef{chen_testing_2012}{rmelting}
#'
#' \insertRef{dumousseau_melting_2012}{rmelting}
#'
#' @seealso For more details about algorithm, formulae and methods, see the
#' documentation for
#' \href{https://www.ebi.ac.uk/biomodels-static/tools/melting/melting5-doc/melting.html}{MELTING
#' 5}.
#'
#' @examples
#'
#' # Basic usage
#' melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
#' hybridisation.type = "dnadna", Na.conc = 1)
#'
#' # For more detailed examples refer the vignette.
#' \dontrun{
#'
#' browseVignettes(package = 'rmelting')
#' }
#'
melting <- function(sequence, comp.sequence = NULL,
nucleic.acid.conc,
hybridisation.type = c("dnadna", "rnarna", "dnarna",
"rnadna", "mrnarna", "rnamrna"),
Na.conc, Mg.conc, Tris.conc, K.conc,
dNTP.conc, DMSO.conc, formamide.conc,
size.threshold = 60, force.self = FALSE, correction.factor,
method.approx = c("ahs01", "che93", "che93corr",
"schdot", "owe69", "san98", "wetdna91",
"wetrna91", "wetdnarna91"),
method.nn = c("all97", "bre86", "san04", "san96", "sug96",
"tan04", "fre86", "xia98", "sug95", "tur06"),
method.GU = c("tur99", "ser12"),
method.singleMM = c("allsanpey", "tur06", "zno07",
"zno08", "wat11"),
method.tandemMM = c("allsanpey", "tur99"),
method.single.dangle = c("bom00", "sugdna02",
"sugrna02", "ser08"),
method.double.dangle = c("sugdna02", "sugrna02",
"ser05", "ser06"),
method.long.dangle = c("sugdna02", "sugrna02"),
method.internal.loop = c("san04", "tur06", "zno07"),
method.single.bulge.loop = c("tan04", "san04",
"ser07", "tur06"),
method.long.bulge.loop = c("san04", "tur06"),
method.CNG = c("bro05"),
method.inosine = c("san05", "zno07"),
method.hydroxyadenine = c("sug01"),
method.azobenzenes = c("asa05"), method.locked = c("mct04"),
correction.ion = c("ahs01", "kam71", "marschdot",
"owc1904", "owc2004", "owc2104",
"owc2204", "san96", "san04", "schlif",
"tanna06", "tanna07", "wet91",
"owcmg08", "tanmg06", "tanmg07",
"owcmix08", "tanmix07"),
method.Naeq = c("ahs01", "mit96", "pey00"),
correction.DMSO = c("ahs01", "cul76", "esc80", "mus81"),
correction.formamide = c("bla96", "lincorr")) {
##################################################
# Checks for mandatory arguments
##################################################
#-----------------------------------------------------------------------------
# Check if mandatory argument sequence is present
if (missing(sequence)) {
stop("The mandatory argument 'sequence' is missing.")
}
# Check if sequence is of type character with unit length
if (!is.character(sequence) || length(sequence) != 1) {
stop("'sequence' should be a character vector of length 1.")
}
#-----------------------------------------------------------------------------
# Check if mandatory argument nucleic.acid.conc is present
if (missing(nucleic.acid.conc)) {
stop("The mandatory argument 'nucleic.acid.conc' is missing.")
}
# Check if argument nucleic.acid.conc is of type numeric with unit length
if (!is.numeric(nucleic.acid.conc) || length(nucleic.acid.conc) != 1) {
stop("'nucleic.acid.conc' should be a numeric vector of length 1.")
}
#-----------------------------------------------------------------------------
# Check if mandatory argument hybridisation.type is present
if (missing(hybridisation.type)) {
stop("The mandatory argument 'hybridisation.type' is missing.")
}
# Check argument hybridisation.type
hybridisation.type <- match.arg(hybridisation.type)
# Check if argument hybridisation.type is of type character with unit length
if (!is.character(hybridisation.type) || length(hybridisation.type) != 1) {
stop("'hybridisation.type' should be a character vector of length 1.")
}
#-----------------------------------------------------------------------------
# Check if inosine(s) or hydroxyadenine(s) are present in sequence
if (missing(comp.sequence)) {
i.check <- grepl("i", sequence, ignore.case = TRUE)
ha.check <- grepl("a\\*", sequence, ignore.case = TRUE)
if (TRUE %in% c(i.check, ha.check)) {
stop("The argument 'comp.sequence' is required if there are",
"inosine(s) [I] or hydroxyadenine(s) [A*] in the 'sequence'")
}
}
#-----------------------------------------------------------------------------
# Check if at least one of the ion concentrations are present
ion.check <- c(missing(Na.conc), missing(Mg.conc), missing(Tris.conc),
missing(K.conc))
if (!(FALSE %in% ion.check)) {
stop("At least one of these arguments specifying ion concentration",
"should be provided:",
"\n'Na.conc', 'Mg.conc', 'Tris.conc', 'K.conc'")
}
# Check if argument nucleic.acid.conc is of type numeric with unit length
if (!missing(Na.conc)) {
if (!is.numeric(Na.conc) || length(Na.conc) != 1) {
stop("'Na.conc' should be a numeric vector of length 1.")
}
}
# Check if argument nucleic.acid.conc is of type numeric with unit length
if (!missing(Mg.conc)) {
if (!is.numeric(Mg.conc) || length(Mg.conc) != 1) {
stop("'Mg.conc' should be a numeric vector of length 1.")
}
}
# Check if argument Tris.conc is of type numeric with unit length
if (!missing(Tris.conc)) {
if (!is.numeric(Tris.conc) || length(Tris.conc) != 1) {
stop("'Tris.conc' should be a numeric vector of length 1.")
}
}
# Check if argument K.conc is of type numeric with unit length
if (!missing(K.conc)) {
if (!is.numeric(K.conc) || length(K.conc) != 1) {
stop("'K.conc' should be a numeric vector of length 1.")
}
}
#-----------------------------------------------------------------------------
##################################################
# Checks for other arguments
##################################################
#-----------------------------------------------------------------------------
# Check if argument dNTP.conc is of type numeric with unit length
if (!missing(dNTP.conc)) {
if (!is.numeric(dNTP.conc) || length(dNTP.conc) != 1) {
stop("'dNTP.conc' should be a numeric vector of length 1.")
}
}
# Check if argument DMSO.conc is of type numeric with unit length
if (!missing(DMSO.conc)) {
if (!is.numeric(DMSO.conc) || length(DMSO.conc) != 1) {
stop("'DMSO.conc' should be a numeric vector of length 1.")
}
}
# Check if argument formamide.conc is of type numeric with unit length
if (!missing(formamide.conc)) {
if (!is.numeric(formamide.conc) || length(formamide.conc) != 1) {
stop("'formamide.conc' should be a numeric vector of length 1.")
}
}
#-----------------------------------------------------------------------------
# Check if argument size.threshold is of type numeric with unit length
if (!is.numeric(size.threshold) || length(size.threshold) != 1) {
stop("'size.threshold' should be a numeric vector of length 1.")
}
#-----------------------------------------------------------------------------
# Check argument force.self
if (!missing(force.self)) {
if (!is.logical(force.self) || length(force.self) != 1) {
stop("'force.self' should be logical vector of length 1.")
}
}
#-----------------------------------------------------------------------------
# Check argument correction.factor
if (!missing(correction.factor)) {
if (!is.numeric(correction.factor) || length(correction.factor) != 1) {
stop("'correction.factor' should be numeric vector of length 1.")
}
}
#-----------------------------------------------------------------------------
# Check argument method.approx
if (!missing(method.approx)) {
method.approx <- match.arg(method.approx)
}
# Check argument method.nn
if (!missing(method.nn)) {
method.nn <- match.arg(method.nn)
}
#-----------------------------------------------------------------------------
# Check argument method.GU
if (!missing(method.GU)) {
method.GU <- match.arg(method.GU)
}
#-----------------------------------------------------------------------------
# Check argument method.singleMM
if (!missing(method.singleMM)) {
method.singleMM <- match.arg(method.singleMM)
}
#-----------------------------------------------------------------------------
# Check argument method.tandemMM
if (!missing(method.tandemMM)) {
method.tandemMM <- match.arg(method.tandemMM)
}
#-----------------------------------------------------------------------------
# Check argument method.single.dangle
if (!missing(method.single.dangle)) {
method.single.dangle <- match.arg(method.single.dangle)
}
#-----------------------------------------------------------------------------
# Check argument method.double.dangle
if (!missing(method.double.dangle)) {
method.double.dangle <- match.arg(method.double.dangle)
}
#-----------------------------------------------------------------------------
# Check argument method.long.dangle
if (!missing(method.long.dangle)) {
method.long.dangle <- match.arg(method.long.dangle)
}
#-----------------------------------------------------------------------------
# Check argument method.internal.loop
if (!missing(method.internal.loop)) {
method.internal.loop <- match.arg(method.internal.loop)
}
#-----------------------------------------------------------------------------
# Check argument method.single.bulge.loop
if (!missing(method.single.bulge.loop)) {
method.single.bulge.loop <- match.arg(method.single.bulge.loop)
}
#-----------------------------------------------------------------------------
# Check argument method.long.bulge.loop
if (!missing(method.long.bulge.loop)) {
method.long.bulge.loop <- match.arg(method.long.bulge.loop)
}
#-----------------------------------------------------------------------------
# Check argument method.CNG
if (!missing(method.CNG)) {
method.CNG <- match.arg(method.CNG)
}
#-----------------------------------------------------------------------------
# Check argument method.inosine
if (!missing(method.inosine)) {
method.inosine <- match.arg(method.inosine)
}
#-----------------------------------------------------------------------------
# Check argument method.hydroxyadenine
if (!missing(method.hydroxyadenine)) {
method.hydroxyadenine <- match.arg(method.hydroxyadenine)
}
#-----------------------------------------------------------------------------
# Check argument method.azobenzenes
if (!missing(method.azobenzenes)) {
method.azobenzenes <- match.arg(method.azobenzenes)
}
#-----------------------------------------------------------------------------
# Check argument method.locked
if (!missing(method.locked)) {
method.locked <- match.arg(method.locked)
}
#-----------------------------------------------------------------------------
# Check argument correction.ion
if (!missing(correction.ion)) {
correction.ion <- match.arg(correction.ion)
}
#-----------------------------------------------------------------------------
# Check argument method.Naeq
if (!missing(method.Naeq)) {
method.Naeq <- match.arg(method.Naeq)
}
#-----------------------------------------------------------------------------
# Check argument correction.DMSO
if (!missing(correction.DMSO)) {
correction.DMSO <- match.arg(correction.DMSO)
}
#-----------------------------------------------------------------------------
# Check argument correction.formamide
if (!missing(correction.formamide)) {
correction.formamide <- match.arg(correction.formamide)
}
#-----------------------------------------------------------------------------
##################################################
# Build options - General
##################################################
missing2 <- function(x) {
if (missing(x)) {
NA
} else{
x
}
}
eopt <- data.frame(ion_agent = c("Na", "Mg", "Tris", "K",
"dNTP", "DMSO", "formamide"),
earg = c("Na.conc", "Mg.conc", "Tris.conc", "K.conc",
"dNTP.conc", "DMSO.conc", "formamide.conc"),
echeck = c(missing(Na.conc), missing(Mg.conc),
missing(Tris.conc), missing(K.conc),
missing(dNTP.conc), missing(DMSO.conc),
missing(formamide.conc)),
eval = c(missing2(Na.conc), missing2(Mg.conc),
missing2(Tris.conc), missing2(K.conc),
missing2(dNTP.conc), missing2(DMSO.conc),
missing2(formamide.conc)),
stringsAsFactors = FALSE)
# eopt <- data.frame(ion_agent = c("Na", "Mg", "Tris", "K",
# "dNTP", "DMSO", "formamide"),
# earg = c("Na.conc", "Mg.conc", "Tris.conc", "K.conc",
# "dNTP.conc", "DMSO.conc", "formamide.conc"),
# echeck = tf(0.05,0.25),
# eval = tf2(0.05,0.25))
eopt <- eopt[eopt$echeck == FALSE, ]
# Generate input for -E
eopts <- paste(paste0(eopt$ion_agent, "=", eopt$eval), collapse = ":")
# Mandatory options 1
opts <- c(
"-S", sequence,
"-H", hybridisation.type,
"-P", nucleic.acid.conc,
"-E", eopts
)
# Mandatory options 2: comp.sequence
if (!missing(comp.sequence)) {
opts <- c(opts,
"-C", comp.sequence)
}
# General options: size.threshold
opts <- c(opts, "-T", size.threshold)
# General options: force.self
if (force.self) {
opts <- c(opts, "-self")
}
# General options: correction.factor
if (!missing(correction.factor)) {
opts <- c(opts, "-F", correction.factor)
}
##################################################
# Build options - Specific
##################################################
# Options: method.approx
if (!missing(method.approx)) {
opts <- c(opts, "-am", method.approx)
}
# Options: method.nn
if (!missing(method.nn)) {
opts <- c(opts, "-nn", method.nn)
}
# Options: method.GU
if (!missing(method.GU)) {
opts <- c(opts, "-GU", method.GU)
}
# Options: method.singleMM
if (!missing(method.singleMM)) {
opts <- c(opts, "-sinMM", method.singleMM)
}
# Options: method.tandemMM
if (!missing(method.tandemMM)) {
## Bug in -tan in MELTING 5 when "tur99" or "allsanpey"
if (method.tandemMM == "tur99" | method.tandemMM == "allsanpey") {
# method.tandemMM <- "tur06"
} else {
opts <- c(opts, "-tanMM", method.tandemMM)
}
}
# Options: method.single.dangle
if (!missing(method.single.dangle)) {
opts <- c(opts, "-sinDE", method.single.dangle)
}
# Options: method.double.dangle
if (!missing(method.double.dangle)) {
opts <- c(opts, "-secDE", method.double.dangle)
}
# Options: method.long.dangle
if (!missing(method.long.dangle)) {
opts <- c(opts, "-lonDE", method.long.dangle)
}
# Options: method.internal.loop
if (!missing(method.internal.loop)) {
opts <- c(opts, "-intLP", method.internal.loop)
}
# Options: method.single.bulge.loop
if (!missing(method.single.bulge.loop)) {
opts <- c(opts, "-sinBU", method.single.bulge.loop)
}
# Options: method.long.bulge.loop
if (!missing(method.long.bulge.loop)) {
opts <- c(opts, "-lonBU", method.long.bulge.loop)
}
# Options: method.CNG
if (!missing(method.CNG)) {
opts <- c(opts, "-CNG", method.CNG)
}
# Options: method.inosine
if (!missing(method.inosine)) {
opts <- c(opts, "-ino", method.inosine)
}
# Options: method.hydroxyadenine
if (!missing(method.hydroxyadenine)) {
opts <- c(opts, "-ha", method.hydroxyadenine)
}
# Options: method.azobenzenes
if (!missing(method.azobenzenes)) {
opts <- c(opts, "-azo", method.azobenzenes)
}
# Options: method.locked
if (!missing(method.locked)) {
opts <- c(opts, "-lck", method.locked)
}
# Options: correction.ion
if (!missing(correction.ion)) {
opts <- c(opts, "-ion", correction.ion)
}
# Options: method.Naeq
if (!missing(method.Naeq)) {
opts <- c(opts, "-naeq", method.Naeq)
}
# Options: correction.DMSO
if (!missing(correction.DMSO)) {
opts <- c(opts, "-DMSO", correction.DMSO)
}
# Options: correction.formamide
if (!missing(correction.formamide)) {
opts <- c(opts, "-for", correction.formamide)
}
# Add verbose
# opts <- c(opts, "-O", "test.txt")
# opts <- c(opts, "-v")
##################################################
# Get results
##################################################
meltj <- rJava::new(J("melting.Main"))
optionManager <- rJava::new(J("melting.configuration.OptionManagement"))
#results <- meltj$getMeltingResults(opts, optionManager)
# Check for error and/or warning(s) and Fetch result
pResults <- withWE(meltj$getMeltingResults(opts, optionManager))
# Check for error and/or warning(s) and Fetch environment
pEnv <- withWE(optionManager$createEnvironment(opts))
if (isS4(pEnv$value) && .jinstanceof(pEnv$value,
J("melting.Environment"))) {
# Get environment
env <- pEnv$value
envir_melt <- list(`Sequence` = env$getSequences()$getSequence(),
`Complementary sequence` = env$getSequences()$getComplementary(),
`Nucleic acid concentration (M)` = env$getNucleotides(),
`Hybridization type` = env$getHybridization(),
`Na concentration (M)` = env$getNa(),
`Mg concentration (M)` = env$getMg(),
`Tris concentration (M)` = env$getTris(),
`K concentration (M)` = env$getK(),
`dNTP concentration (M)` = env$getDNTP(),
`DMSO concentration (%)` = env$getDMSO(),
`Formamide concentration (M or %)` = env$getFormamide(),
`Self complementarity` = env$isSelfComplementarity(),
`Correction factor` = env$getFactor())
# Get options
opt_names <- c("-tan", "-P", "-S", "-T", "-DMSO", "-secDE", "-ino",
"-sinBU", "-lonDE", "-lck", "-self", "-am", "-sinDE",
"-azo", "-lonBU", "-naeq", "-intLP", "-ha", "-for", "-nn",
"-NNPath", "-C", "-E", "-F", "-sinMM", "-H", "-mode", "-GU",
"-CNG", "-ion")
opt_names <- setdiff(opt_names, "-NNPath")
opts_melt <- env$getOptions()
keySet <- .jrcall(opts_melt, "keySet")
opts_iter <- .jrcall(keySet, "iterator")
# opts_melt2 <- list()
opts_melt2 <- vector(length = length(opt_names), mode = "list")
names(opts_melt2) <- opt_names
while (.jrcall(opts_iter, "hasNext")) {
key <- .jrcall(opts_iter, "next")
opts_melt2[[key]] <- .jrcall(opts_melt, "get", key)
}
options_melt <- list(`Approximative formula` = opts_melt2$`-am`,
`Nearest neighbour model` = opts_melt2$`-nn`,
`GU model` = opts_melt2$`-GU`,
`Single mismatch model` = opts_melt2$`-sinMM`,
`Tandem mismatch model` = opts_melt2$`-tan`,
`Single dangling end model` = opts_melt2$`-sinDE`,
`Double dangling end model` = opts_melt2$`-secDE`,
`Long dangling end model` = opts_melt2$`-lonDE`,
`Internal loop model` = opts_melt2$`-intLP`,
`Single bulge loop model` = opts_melt2$`-sinBU`,
`Long bulge loop model` = opts_melt2$`-lonBU`,
`CNG repeats model` = opts_melt2$CNG,
`Inosine bases model` = opts_melt2$`-ino`,
`Hydroxyadenine bases model` = opts_melt2$`-ha`,
`Azobenzenes model` = opts_melt2$`-azo`,
`Locked nucleic acids model` = opts_melt2$`-lck`,
`Ion correction method` = opts_melt2$`-ion`,
`Na equivalence correction method` = opts_melt2$`-naeq`,
`DMSO correction method` = opts_melt2$`-DMSO`,
`Formamide correction method` = opts_melt2$`-for`,
Mode = opts_melt2$`-mode`)
} else {
envir_melt <- list(`Sequence` = NA,
`Complementary sequence` = NA,
`Nucleic acid concentration (M)` = NA,
`Hybridization type` = NA,
`Na concentration (M)` = NA,
`Mg concentration (M)` = NA,
`Tris concentration (M)` = NA,
`K concentration (M)` = NA,
`dNTP concentration (M)` = NA,
`DMSO concentration (%)` = NA,
`Formamide concentration (M or %)` = NA,
`Self complementarity` = NA,
`Correction factor` = NA)
options_melt <- list(`Approximative formula` = NA,
`Nearest neighbour model` = NA,
`GU model` = NA,
`Single mismatch model` = NA,
`Tandem mismatch model` = NA,
`Single dangling end model` = NA,
`Double dangling end model` = NA,
`Long dangling end model` = NA,
`Internal loop model` = NA,
`Single bulge loop model` = NA,
`Long bulge loop model` = NA,
`CNG repeats model` = NA,
`Inosine bases model` = NA,
`Hydroxyadenine bases model` = NA,
`Azobenzenes model` = NA,
`Locked nucleic acids model` = NA,
`Ion correction method` = NA,
`Na equivalence correction method` = NA,
`DMSO correction method` = NA,
`Formamide correction method` = NA,
Mode = NA)
}
# Get Results
if (isS4(pResults$value) && .jinstanceof(pResults$value,
J("melting.ThermoResult"))) {
results <- pResults$value
# Fetch calculation method
calculMethod <- results$getCalculMethod()
if (.jinstanceof(calculMethod,
J("melting.nearestNeighborModel.NearestNeighborMode"))) {
options_melt$`Approximative formula` <- NA_character_
} else {
options_melt$`Nearest neighbour model` <- NA_character_
}
# Fetch enthalpy and entropy for nearest-neighbour methods
if (.jinstanceof(calculMethod,
J("melting.nearestNeighborModel.NearestNeighborMode"))) {
enthalpy_cal <- results$getEnthalpy()
entropy_cal <- results$getEntropy()
enthalpy_J <- entropy_J <- NULL
enthalpy_J <- results$getEnergyValueInJ(enthalpy_cal)
entropy_J <- results$getEnergyValueInJ(entropy_cal)
} else {# NA for approximative methods
enthalpy_cal <- NA_integer_
entropy_cal <- NA_integer_
enthalpy_J <- NA_integer_
entropy_J <- NA_integer_
}
melting_temp_C <- results$getTm()
# Get melting results
results_melt <- list(`Enthalpy (cal)` = enthalpy_cal,
`Entropy (cal)` = entropy_cal,
`Enthalpy (J)` = enthalpy_J,
`Entropy (J)` = entropy_J,
`Melting temperature (C)` = melting_temp_C)
} else {
results_melt <- list(`Enthalpy (cal)` = NA,
`Entropy (cal)` = NA,
`Enthalpy (J)` = NA,
`Entropy (J)` = NA,
`Melting temperature (C)` = NA)
}
msg <- c(pEnv$message, pResults$message)
if(!all(is.na(msg))) {
msg <- paste(setdiff(msg, NA), collapse = "\n")
} else {
msg <- NA
}
out <- list(Environment = envir_melt,
Options = replace(options_melt,
vapply(options_melt, is.null,
logical(length = 1)),
NA_character_),
Results = results_melt,
Message = msg)
attr(out, "command") <- paste(opts, collapse = " ")
# Set Class
class(out) <- "melting"
return(out)
}
Try the rmelting package in your browser
Any scripts or data that you put into this service are public.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.