R/slipped.R

Defines functions slipped_motif_base slipped_motif_main slipped

Documented in slipped

slipped_motif_base <- function(a){
  # replace spaces with nothing
  aSpace <- gsub("-", "", a)
  a <- aSpace
  if(nchar(a) < 10) return(data.frame("sequence_position" = "-", "sequence" = "-", "sequence_length" = "-", "likeliness" = "-"))


  # main strand
  a4 <- "([ACGTRYSWKMBDHVN]{5,100})([ACGTRYSWKMBDHVN]{0,500})\\1"
  a5 <- gregexpr(a4, a, ignore.case = TRUE, perl = T)
  sequence_position <- a5[[1]][1:length(a5[[1]])]
  if(a5[[1]][1] == -1){
    resultClean5 <- data.frame("sequence_position" = "-", "sequence" = "-", "sequence_length" = "-", "likeliness" = "-")
  }else{
    a8 <- regmatches(a, a5)
    sequence <- a8[[1]][1:length(a8[[1]])]
    sequence_length <- nchar(sequence)


    ####### Likeliness

    likeliness <- ""
    for(sequ in sequence){
      if((gregexpr("^([ACGTRYSWKMBDHVN]{5,20})\\1$", sequ, ignore.case = TRUE))[[1]][1] == 1){
        sequlikely <- "**"
      }else{
        sequlikely <- "*"
      }
      likeliness <- c(likeliness, sequlikely)
    }
    likeliness <- likeliness[2:length(likeliness)]
    a10 <- cbind(sequence_position, sequence, sequence_length, likeliness)
    resultClean5 <- data.frame(a10)
  }
  return(resultClean5)
}

slipped_motif_main <- function(b){
  if(length(b) == 1){
    #remove newlines
    b <- gsub("[\r\n]", "", b)
    b <- gsub(" ", "", b)
    # exit if unacceptable characters exist
    if(grepl("[^acgtryswkmbdhvnACGTRYSWKMBDHVN-]", b) == "TRUE"){
      b1 <- data.frame ("sequence_position" = "!", "sequence" = "Error: Non-DNA character(s) in input", "sequence_length" = "!", "likeliness" = "!")
      return(b1)
    }else{
      # else continue
      b1 <- slipped_motif_base(b)
      return(b1)
    }

  }else{
    # exit if unacceptable characters exist
    input_pos = 0
    q <- data.frame("input_ID" = integer(0), "sequence_position" = character(0), "sequence" = character(0), "sequence_length" = character(0), "likeliness" = character(0) )
    for(i in b){
      #remove newlines
      b <- gsub("[\r\n]", "", i )
      b <- gsub(" ", "", i)
      # exit if unacceptable characters exist
      if(grepl("[^acgtryswkmbdhvnACGTRYSWKMBDHVN-]", i) == "TRUE"){
        b1 <- data.frame("sequence_position" = "!", "sequence" = "Error: Non-DNA character(s) in input", "sequence_length" = "!", "likeliness" = "!")
      }else{
        b1 <- slipped_motif_base(i)
      }
      input_pos = input_pos + 1
      b2 <- cbind(input_ID = input_pos, b1)
      b2[,c(2,4)] <- sapply(b2[,c(2,4)],as.character)
      q <- rbind(q, b2)
    }
    return(q)
  }
}




#' Predicting slipped motif(s)
#'
#' This function predicts slipped motif(s)
#' in 'x' in DNA. DNA sequence can be provided in raw or fasta format or as GenBank accession number(s).
#' Internet is needed to connect to GenBank database, if accession number(s) is given as argument.
#'
#' @param x DNA sequence(s) in raw format or a fasta file or a GenBank accession number(s); from which slipped motif(s) will be predicted.
#'  If the fasta file name does not contain an absolute path, the file name is relative to the current working directory.
#' @param xformat a character string specifying the format of x : default (raw), fasta, GenBank (GenBank accession number(s)).
#' @return A dataframe of slipped motif(s) position, sequence, length and likeliness. If more than one DNA sequence is provided as argument, an input ID is returned for motif(s) predicted from each input sequence.
#' @author Hannah O. Ajoge
#' @details
#' This function predicts slipped motif(s) in DNA sequences and provide the position, sequence and length of the predicted motif(s). If any motif is predicted, the degree of likeliness for the motif to be formed is computed and scored as ** (more likely) or as * (less likely).
#' @export
#' @importFrom ape read.GenBank
#' @importFrom seqinr read.fasta
#' @importFrom seqinr getSequence
#' @references paper under review
#' @examples
#'  ## Predicting slipped motif(s) from raw DNA sequences
#' E1 <- c("TCTTACTGTGACTGTGGAAT", "taggtgctgggaggtagagacaggatatcct")
#' slipped(E1)
#'
#' ## Predicting slipped motif(s) from DNA sequences in fasta file
#' ## Not run: slipped(x="Example.fasta", xformat = "fasta")
#'
#' ## Predicting slipped motif(s) from DNA sequences,
#' ## using GenBank accession numbers.
#' ## Internet connectivity is needed for this to work.
#' ## Not run: slipped(c("BH114913", "AY611035"), xformat = "GenBank")



slipped <- function(x, xformat = "default"){
  if(xformat == "default"){
    x1 <- slipped_motif_main(x)
    return(x1)
  }

  if(xformat == "GenBank"){
    x2 <- read.GenBank(x, as.character = TRUE)
    x3 <- sapply(x2, paste, collapse="")
    x4 <- slipped_motif_main(x3)
    return(x4)
  }

  if(xformat == "fasta"){
    x5 <-read.fasta(x)
    x6 <- getSequence(x5, as.string = TRUE)
    x7 <- unlist(x6)
    x8 <- slipped_motif_main(x7)
    return(x8)
  }else{
    stop("Unacceptable option for argument 'xformat'")
  }

}

Try the gquad package in your browser

Any scripts or data that you put into this service are public.

gquad documentation built on May 2, 2019, 12:19 p.m.