run_cutadapt: Run Cutadapt

In GrahamHamilton/pipelineTools: Pipeline Tools for NGS Sequence Analysis Pipelines

Run Cutadapt

Description

Run the Cutadapt tool to remove sequencing adapters and low quality bases.

Usage

run_cutadapt(
  input1 = NULL,
  input2 = NULL,
  output1.trim = NULL,
  output2.trim = NULL,
  quality = NULL,
  nextseq = FALSE,
  minimum = NULL,
  trim.only = FALSE,
  cut.for = NULL,
  cut.rev = NULL,
  length = NULL,
  adapter1 = NULL,
  adapter2 = NULL,
  polyA = NULL,
  adapter.5.prime = NULL,
  maximum.error.rate = NULL,
  parallel = FALSE,
  cores = 4,
  execute = TRUE,
  cutadapt = NULL,
  version = FALSE
)

Arguments

input1	List of the paths to files containing to the forward reads
input2	List of the paths to files containing to the reverse reads
output1.trim	List of paths to the files to write the trimmed forward reads
output2.trim	List of paths to the files to write the trimmed reverse reads
quality	The lower limit for the phred score
nextseq	Was the sequence data generated on a NextSeq 500, trims dark cycle bases appearing as high-quality G bases
minimum	The length at which a trimmed read will be discarded
trim.only	Only keep reads that have had adapters trimmed
cut.for	Remove the first 'n' bases form the 5' end of the forward read
cut.rev	Remove the first 'n' bases form the 5' end of the reverse read
length	Shorten each read down to a certain length
adapter1	Sequence for the adapter for the forward read
adapter2	Sequence for the adapter for the reverse read
polyA	Number of A's
adapter.5.prime	Sequence of te 5 prime adapter
maximum.error.rate	Maximum number of errors tolerated, default 0.1 or 10 percent
parallel	Run in parallel, default set to FALSE
cores	Number of cores/threads to use for parallel processing, default set to 4
execute	Whether to execute the commands or not, default set to TRUE
cutadapt	Path to the Cutadapt program, required
version	Returns the version number

Value

A file with the Cutadapt commands and creates a directory of adapter and quality trimmed reads

Examples

 ## Not run: 
 # Version number
 run_cutadapt(cutadapt = cutadapt.path,
                         version = TRUE)

# Trimmed reads directory
trimmed.reads.dir <- "trimmed_reads"
#Create the directory for the trimmed reads
dir.create(trimmed.reads.dir, showWarnings = FALSE)

read1.pattern <- "*_R1_001.fastq.gz$"
read2.pattern <- "*_R2_001.fastq.gz$"

reads.path <- "/export/buzz2/gpfrawdata/nextseq01/FastQ/2019/NeilBulleid/
               1466_NS205_0325_MarieAnnPringle_20190313"

mate1 <- list.files(path = reads.path,
                    pattern = read1.pattern,
                    full.names = TRUE)
mate1.trim <- paste(trimmed.reads.dir,(list.files(path = reads.path,
                                                 pattern = read1.pattern,
                                                 full.names = FALSE)), sep = "/")

mate2 <- list.files(path = reads.path,
                    pattern = read2.pattern,
                    full.names = TRUE)
mate2.trim <- paste(trimmed.reads.dir,(list.files(path = reads.path,
                                                 pattern = read2.pattern,
                                                 full.names = FALSE)), sep = "/")

# Single end
run_cutadapt(input1 = mate1,
             output1.trim = mate1.trim,
             quality = 25,
             minimum = 17,
             trim.only = TRUE,
             cut = 1,
             adapter1 = "AGATCGGAAGAGCACACGTCT",
             cutadapt = cutadapt.path)

# Paired end
run_cutadapt(input1 = mate1,
             input2 = mate2,
             output1.trim = mate1.trim,
             output2.trim = mate2.trim,
             quality = 25,
             minimum = 17,
             trim.only = TRUE,
             cut = 1,
             adapter1 = "AGATCGGAAGAGCACACGTCT",
             adapter1 = "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT",
             cutadapt = cutadapt.path)
 
## End(Not run)

GrahamHamilton/pipelineTools documentation built on Dec. 8, 2024, 3:53 p.m.