run_fastp: Run FastP

In GrahamHamilton/pipelineTools: Pipeline Tools for NGS Sequence Analysis Pipelines

Run FastP

Description

Run the FastP tool to remove contaminating sequencing adapters and low quality bases.

Usage

run_fastp(
  input1 = NULL,
  input2 = NULL,
  output1 = NULL,
  output2 = NULL,
  adapter1 = NULL,
  adapter2 = NULL,
  sample.name = NULL,
  out.dir = NULL,
  phred.quality = 15,
  min.length = NULL,
  trim.front.1 = NULL,
  trim.tail.1 = NULL,
  trim.front.2 = NULL,
  trim.tail.2 = NULL,
  threads = 10,
  parallel = FALSE,
  cores = 4,
  execute = TRUE,
  fastp = NULL,
  version = FALSE
)

Arguments

input1	List of the paths to files containing to the forward reads
input2	List of the paths to files containing to the reverse reads
output1	List of paths to the files to write the trimmed forward reads
output2	List of paths to the files to write the trimmed reverse reads
adapter1	Sequence for the adapter for the forward read
adapter2	Sequence for the adapter for the reverse read
sample.name	List of the sample names
out.dir	Name of the directory to write quality control results files. If NULL, which is the default, a directory named "fastP" is created in the current working directory.
phred.quality	The lower limit for the phred score
min.length	The length at which a trimmed read will be discarded
trim.front.1	Trim 'n' bases from front of read1, default is 0
trim.tail.1	Trim 'n' bases from tail of read1, default is 0
trim.front.2	Trim 'n' bases from front of read2, default is 0
trim.tail.2	Trim 'n' bases from tail of read2, default is 0
threads	Number of threads for FastP to use, default set to 10
parallel	Run in parallel, default set to FALSE
cores	Number of cores/threads to use for parallel processing, default set to 4
execute	Whether to execute the commands or not, default set to TRUE
fastp	Path to the FastP program, required
version	Returns the version number

Value

A file with the FastP commands and creates a directory of adapter and quality trimmed reads

Examples

 ## Not run: 
# Set the directory containing the raw fastq files
reads_path <- "raw_reads"
mate1 <- list.files(path = reads_path, pattern = "*_R1_001.fastq.gz$", full.names = TRUE)
mate2 <- list.files(path = reads_path, pattern = "*_R2_001.fastq.gz$", full.names = TRUE)

# Set the directory for writing the trimmend reads to
trimmed_reads_dir <- "trimmed_reads"
mate1.out <- paste(trimmed_reads_dir,
             (list.files(path = path, pattern = "*_R1_001.fastq.gz$", full.names = FALSE)),
             sep = "/")
mate2.out <- paste(trimmed_reads_dir,
             (list.files(path = path, pattern = "*_R2_001.fastq.gz$", full.names = FALSE)),
             sep = "/")

# Get the sample names from the first reads
sample_names <- unlist(lapply(strsplit
                (list.files(path = path, pattern = "*_R1_001.fastq.gz$", full.names = FALSE),"_"),
                `[[`, 1))

# Set the adapter sequences, these are for Illumina
adapter1 <- "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"
adapter2 <- "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT"

fastp.cmds <- run_fastp(input1 = mate1,
                        input2 = mate2,
                        output1 = mate1.out,
                        output2 = mate2.out,
                        adapter1 = adapter1,
                        adapter2 = adapter2,
                        sample.name =  sample.names,
                        out.dir = fastp.results.dir,
                        fastp = "/software/bin/fastp")

## End(Not run)

GrahamHamilton/pipelineTools documentation built on Dec. 8, 2024, 3:53 p.m.