View source: R/reverse_complement.R
reverse_complement | R Documentation |
Given a DNA sequence, the function generates the reverse complement of the sequence and returns it.
reverse_complement(sequence)
sequence |
A character string containing the DNA sequence to be reversed and complemented |
A character string containing the reverse complement of the input DNA sequence
sequence <- "ATCGAGCTAGCTAGCTAGCTAGCT"
reverse_complement(sequence)
# [1] "AGCTAGCTAGCTAGCTAGCTCGAT"
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.