#' The Trinucleotide-based Cross Covariance Descriptor
#'
#' The Trinucleotide-based Cross Covariance Descriptor
#'
#' This function calculates the trinucleotide-based cross covariance Descriptor
#'
#' @param x the input data, which should be a list or file type.
#'
#' @param index the physicochemical indices, it should be a list and there are 12
#' different physicochemical indices (Table 2), which the users can choose.
#'
#' @param nlag an integer larger than or equal to 0 and less than or equal to L-2 (L means the length
#' of the shortest DNA sequence in the dataset). It represents the distance between two dinucleotides.
#'
#' @param normaliztion with this option, the final feature vector will be normalized based
#' on the total occurrences of all kmers. Therefore, the elements in the feature vectors
#' represent the frequencies of kmers. The default value of this parameter is False.
#'
#' @param customprops the users can use their own indices to generate the feature vector. It should be a dict,
#' the key is dinucleotide (string), and its corresponding value is a list type.
#'
#' @return A vector
#'
#' @keywords extract TCC
#'
#' @aliases extrTCC
#'
#' @author Min-feng Zhu <\email{wind2zhu@@163.com}>
#'
#' @export extrTCC
#'
#' @seealso See \code{\link{extrTAC}} and \code{\link{extrTACC}}
#'
#' @note if the user defined physicochemical indices have not been normalized, it should be normalized.
#'
#' @examples
#'
#' x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
#' extrTCC(x)
#'
extrTCC = function (x, index = c('Dnase I', 'Nucleosome'), nlag = 2,
customprops = NULL, normaliztion = FALSE) {
if (!dnacheck(x))
stop('x has character except A, G, C, T !' )
Tidx = read.csv(system.file('sysdata/12_trinucleotide_physicochemical_indices.csv', package = 'rDNAse'), header = TRUE)
tidx = Tidx[, -1]
row.names(tidx) = Tidx[, 1]
if (!is.null(customprops)) {
tidx = rbind(tidx, customprops)
index = c(as.character(index), rownames(customprops))
}
n = length(index)
####normaliztion####
Tdict = make_kmer_index(k = 3)
if (normaliztion) {
indmean = rowMeans(tidx[index, ])
indsd = apply(tidx[index, ], 1, sd)
Pr = data.frame(matrix(ncol = 64, nrow = n))
for (i in 1:n) Pr[i, ] = (tidx[index[i], ] - indmean[i])/indsd[i]
names(Pr) = Tdict
}
else Pr = tidx[index, ]
xSplit = strsplit(x, split = "")[[1]]
xPaste = paste0(xSplit[1:(length(xSplit) - 2)], xSplit[2:(length(xSplit) - 1)],
xSplit[3:(length(xSplit))])
P = vector('list', n)
for (i in 1:n) P[[i]] = xPaste
for (i in 1:n) {
for (j in Tdict) {
try(P[[i]][which(P[[i]] == j)] <- Pr[i, j], silent = TRUE)
}
}
P = lapply(P, as.numeric)
###########################################################
TCC = vector("numeric", n * (n-1) * nlag)
N = length(xPaste)
idx = combn(1:n, 2)
i = 0
for (k in 1:dim(idx)[2]) {
for (j in 1:nlag) {
Pbar = lapply(seq_along(P), function(i) P[[i]][1:(N-j)])
Pbar = sapply(Pbar, sum)/nchar(x)
TCC[j + 4 * i] = (sum((P[[idx[1, k]]][1:(N - j)] - Pbar[idx[1, k]]) * (P[[idx[2, k]]][(1:(N - j)) + j] - Pbar[idx[2, k]])))/(N-j)
names(TCC)[j + 4 * i] = c(paste(index[idx[1, k]], index[idx[2, k]], 'lag', j, sep = "."))
}
for (j in 1:nlag) {
Pbar = lapply(seq_along(P), function(i) P[[i]][1:(N-j)])
Pbar = sapply(Pbar, sum)/nchar(x)
TCC[(nlag + j) + 4 * i] = (sum((P[[idx[2, k]]][1:(N - j)] - Pbar[idx[2, k]]) * (P[[idx[1, k]]][(1:(N - j)) + j] - Pbar[idx[1, k]])))/(N-j)
names(TCC)[(nlag + j) + 4 * i] = c(paste(index[idx[2, k]], index[idx[1, k]], 'lag', j, sep = "."))
}
i = i + 1
}
TCC = round(TCC, 3)
return(TCC)
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.