phiX174Phage: Versions of bacteriophage phiX174 complete genome and sample...

Description Details References Examples

Description

Six versions of the complete genome for bacteriophage φ X174 as well as a small number of Solexa short reads, qualities associated with those short reads, and counts for the number times those short reads occurred.

Details

The phiX174Phage object is a DNAStringSet containing the following six naturally occurring versions of the bacteriophage φ X174 genome cited in Smith et al.:

Genbank:

The version of the genome from GenBank (NC\_001422.1, GI:9626372).

RF70s:

A preparation of φ X double-stranded replicative form (RF) of DNA by Clyde A. Hutchison III from the late 1970s.

SS78:

A preparation of φ X virion single-stranded DNA from 1978.

Bull:

The sequence of wild-type φ X used by Bull et al.

G'97:

The φ X replicative form (RF) of DNA from Bull et al.

NEB'03:

A φ X replicative form (RF) of DNA from New England BioLabs (NEB).

The srPhiX174 object is a DNAStringSet containing short reads from a Solexa machine.

The quPhiX174 object is a BStringSet containing Solexa quality scores associated with srPhiX174.

The wtPhiX174 object is an integer vector containing counts associated with srPhiX174.

References

http://www.genome.jp/dbget-bin/www_bget?refseq+NC_001422

Bull, J. J., Badgett, M. R., Wichman, H. A., Huelsenbeck, Hillis, D. M., Gulati, A., Ho, C. & Molineux, J. (1997) Genetics 147, 1497-1507.

Smith, Hamilton O.; Clyde A. Hutchison, Cynthia Pfannkoch, J. Craig Venter (2003-12-23). "Generating a synthetic genome by whole genome assembly: {phi}X174 bacteriophage from synthetic oligonucleotides". Proceedings of the National Academy of Sciences 100 (26): 15440-15445. doi:10.1073/pnas.2237126100.

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
16
data(phiX174Phage)
nchar(phiX174Phage)
genBankPhage <- phiX174Phage[[1]]
genBankSubstring <- substring(genBankPhage, 2793-34, 2811+34)

data(srPhiX174)
srPhiX174
quPhiX174
summary(wtPhiX174)

alignPhiX174 <-
  pairwiseAlignment(srPhiX174, genBankSubstring,
                    patternQuality = SolexaQuality(quPhiX174),
                    subjectQuality = SolexaQuality(99L),
                    type = "global-local")
summary(alignPhiX174, weight = wtPhiX174)

Example output

Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: 'BiocGenerics'

The following objects are masked from 'package:parallel':

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from 'package:stats':

    IQR, mad, sd, var, xtabs

The following objects are masked from 'package:base':

    Filter, Find, Map, Position, Reduce, anyDuplicated, append,
    as.data.frame, cbind, colMeans, colSums, colnames, do.call,
    duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
    lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int,
    pmin, pmin.int, rank, rbind, rowMeans, rowSums, rownames, sapply,
    setdiff, sort, table, tapply, union, unique, unsplit, which,
    which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: 'S4Vectors'

The following object is masked from 'package:base':

    expand.grid

Loading required package: IRanges
Loading required package: XVector

Attaching package: 'Biostrings'

The following object is masked from 'package:base':

    strsplit

[1] 5386 5386 5386 5386 5386 5386
  A DNAStringSet instance of length 1113
       width seq
   [1]    35 GTTATTATACCGTCAAGGACTGTGTGACTATTGAC
   [2]    35 GGTGGTTATTATACCGTCAAGGACTGTGTGACTAT
   [3]    35 TACCGTCAAGGACTGTGTGACTATTGACGTCCTTC
   [4]    35 GTACGCCGGGCAATAATGTTTATGTTGGTTTCATG
   [5]    35 GGTTTCATGGTTTGGTCTAACTTTACCGCTACTAA
   ...   ... ...
[1109]    35 ATAATGTTTATGTTGGTTTCATGGTTTGTTCTATC
[1110]    35 GGGCAATAATGTTTATGTTGGTTTCATTTTTTTTT
[1111]    35 CAATAATGTTTATGTTGGTTTCATGGTTTGTTTTA
[1112]    35 GACGTCCTTCCTCGTACGCCGGGCAATGATGTTTA
[1113]    35 ACGCCGGGCAATAATGTTTATGTTGTTTTCATTGT
  A BStringSet instance of length 1113
       width seq
   [1]    35 ZYZZZZZZZZZYYZZYYYYYYYYYYYYYYYYYQYY
   [2]    35 ZZYZZYZZZZYYYYYYYYYYYYYYYYYYYVYYYTY
   [3]    35 ZZZYZYYZYYZYYZYYYYYYYYYYYYYYVYYYYYY
   [4]    35 ZZYZZZZZZZZZYZTYYYYYYYYYYYYYYYYYNYT
   [5]    35 ZZZZZZYZYYZZZYYYYYYYYYYYYYYYYYSYYSY
   ...   ... ...
[1109]    35 ZZZZZYZZZYZYZZVYYYYVYYYQYYYQCYQYQCT
[1110]    35 YYYYTYYYYYTYYYYYYYYTJTTYOAYIIYYYGAY
[1111]    35 ZZYZZZZZZZZZZVZYYVYYYYYYVQYYYIQYAYW
[1112]    35 YZYZZYYYZYYYYYYVYYVYYYYWWVYYYYYWYYV
[1113]    35 ZZYYZYYYYYYZYVZYYYYYYVYYJAYYYIGYCJY
   Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
   2.00    2.00    3.00   48.34    6.00  965.00 
Global-Local Single Subject Pairwise Alignments
Number of Alignments:  53802

Scores:
   Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
 -45.08   35.81   50.07   41.24   59.50   67.35 

Number of matches:
   Min. 1st Qu.  Median    Mean 3rd Qu.    Max. 
  21.00   31.00   33.00   31.46   34.00   35.00 

Top 10 Mismatch Counts:
   SubjectPosition Subject Pattern Count Probability
1               53       C       T 22965  0.95536234
2               35       C       T 22849  0.99969373
3               76       G       T  1985  0.10062351
4               69       A       T  1296  0.05654697
5               79       C       T  1289  0.07289899
6               58       A       C  1153  0.04783637
7               72       G       A  1130  0.05248978
8               63       G       A  1130  0.04767731
9               67       T       G  1130  0.04721514
10              81       A       G  1103  0.06672313

Biostrings documentation built on May 2, 2018, 4:04 a.m.