tests/testthat/setup.R

## libs -----------------------------------------------------------------------
library(BSgenome.Hsapiens.UCSC.hg19)

## general --------------------------------------------------------------------
set.seed(789)
ir <- IRanges(1L,5L)
gr <- GRanges("chr1", ir, score=1)
ir2 <- IRanges(2L,6L)
gr2 <- GRanges("chr1", ir2, score=2)
dna.sq <- DNAStringSet(c(chr1=paste(sample(DNA_BASES, 100, replace=TRUE), collapse="")))
rna.sq <- RNAStringSet(c(chr1=paste(sample(RNA_BASES, 100, replace=TRUE), collapse="")))
cyto.bands <- data.frame(chrom = rep(c("chrI", "chrII"), each=4),
                         chromStart = rep(c(1L, 148071L, 151524L, 154977L),2),
                         chromEnd = rep(c(148071L, 151524L, 154977L, 230218L),2),
                         name = rep(c(NA, "CEN1", "CEN1", NA),2),
                         gieStain = rep(c("gneg", "acen", "acen", "gneg"),2),
                         stringsAsFactors = FALSE)
## internet access ------------------------------------------------------------
hasUcscConnection <- !is(try(rtracklayer::browserSession(), silent=TRUE), "try-error")
check_ucsc <- function() {
    if (!hasUcscConnection) {
        skip("UCSC not available")
    }
}

oto <- options(timeout=5)
hasBiomartConnection <- (!is(try(download.file("http://www.biomart.org", tempfile(), quiet=TRUE)), "try-error") &&
                         !is(try(biomaRt::listMarts(), silent=TRUE), "try-error"))
options(timeout=oto)
check_biomart <- function() {
    if (!hasBiomartConnection) {
        skip("Biomart not available")
    }
}


## Uncommenting this helps when the UCSC server has a hickup but still lets you connect:
## hasUcscConnection <- !is(try(rtracklayer::browserSession(), silent=TRUE), "try-error") &&
##   !is(try(IdeogramTrack(genome="hg19", chromosome=7), silent=TRUE), "try-error")

## tmp files ------------------------------------------------------------------
## BAM file
sam <- c("@HD	VN:1.0	GO:none	SO:coordinate",
         "@SQ	SN:chr1	LN:267910886",
         "@PG	ID:SpliceMap	VN:3.3.5.2 (55)",
         "@CO	file merged using Picard tools",
         "NRCHBS-WDL30299:125:D1415ACXX:8:2215:20868:43279	65	chr1	189891483	255	15S51M6207N10M	=	189897797	47	CGGGACCGTGGTGAGTCAGCGAGTAGGAACTACTCAGGAACTACTCACTTCACTGACAGCCGTAAGTCACTCTGAC	;99;;;5((2@:-)()2:?<88;196?<??1))<>=9?9>>?<>??8>1>>=?;?>?;3=?<9===9=>==>>77=	XS:A:+	NM:i:0	XC:i:15",
         "NRCHBS-WDL30299:126:D14UTACXX:8:2113:17433:81932	177	chr1	189892202	255	76M	=	189892390	113	GCCAAATCAATTCTTTCTTCTCCTAAGCTGCTTTGGTTAGGGTCGTTTATCACAGCAACAGAAAAGTAAGTAAAAC	CC@FFFFFHHHHHJJJIJJIJJJJIJJJJIJJJJJIJJJIIJDGHHIFJJJJIJJJIJJJJJFIJJHHHHHHHHFC	NM:i:0	XC:i:0",
         "NRCHBS-WDL30299:126:D14UTACXX:8:2113:17433:81932	113	chr1	189892390	255	76M	=	189892202	113	GGGCTTTTGCAGGGTTGGGCTGTCCTCCCCTGCCTCTTCTCCAGCCCTTTAATCTTTCAGCACCCAGATCAAGCCG	CCCFFFFFHHHHHJCGHGIIJJIIJJIJJJIJJIJJGHHJIJIIJJJJJIIIGEHHFFFFDDDDDDDDDDDDCBD9	MD:Z:14C61	NM:i:1	XC:i:0",
         "NRCHBS-WDL30299:125:D1415ACXX:8:1313:16113:75579	65	chr1	189893347	255	76M	=	189893470	48	CTGCAGCGGCTCATACAAGACCTTTGCTTAATAGGGTTTTCTTTACCCTAGAAAAATTCCCCTGTGATTTAAGGGT	CCCFFFFFHHHHHJJJJJJIJJJJJJJJJJJJJJJJFHIJJJJJJJJJJJJJJJJIJJJJJJGHHHHFFFFFFDEA	NM:i:0	XC:i:0",
         "NRCHBS-WDL30299:126:D14UTACXX:8:2215:4526:88225	65	chr1	189893352	255	76M	=	189893457	30	GCGGCTCATACAAGACCTTTGCTTAATAGGGTTTTCTTTACCCTAGAAAAATTCCCCTGTGATTTAAGGGTACAGA	@@@DDADDHAF3CGBFH@HIIIEGIGEEHII?CBGDAFHIGFFGIIEGCH@EHGBFHEGCGGCCHICEGG6ACEHE	NM:i:0	XC:i:0")
samfile <- tempfile(fileext = ".sam")
cat(paste(sam, collapse="\n"), file=samfile)
bamfile <- Rsamtools::asBam(samfile, indexDestination = TRUE)

## FASTA
fastafile <- system.file("extdata/test.fa", package="Gviz")

bamgr <- GRanges("chr1", IRanges(c(189892390L, 189892202L, 189893347L, 189891483L, 189893352L),
                                 c(189892465L, 189892277L, 189893422L, 189891558L, 189893427L)),
                 strand=rep(c("-","+"), c(2,3)))
mcols(bamgr) <- DataFrame(id=c("NRCHBS-WDL30299:126:D14UTACXX:8:2113:17433:81932",
                               "NRCHBS-WDL30299:126:D14UTACXX:8:2113:17433:81932",
                               "NRCHBS-WDL30299:125:D1415ACXX:8:1313:16113:75579",
                               "NRCHBS-WDL30299:125:D1415ACXX:8:2215:20868:43279",
                               "NRCHBS-WDL30299:126:D14UTACXX:8:2215:4526:88225"),
                          cigar=c("76M", "76M", "76M", "15S51M6207N10M", "76M"),
                          mapq=rep(255L, 5),
                          flag=c(113L, 177L, 65L, 65L, 65L),
                          md=c("14C61", NA, NA, NA, NA),
                          seq=DNAStringSet(c(`1`=paste(rep("+", 2600), collapse=""),
                                             `2`=paste(rep("+", 2600), collapse=""),
                                             `3`=paste(rep("+", 2600), collapse=""),
                                             `4`=paste(rep("+", 2600), collapse=""),
                                             `5`=paste(rep("+", 2600), collapse=""))),
                          isize=c(113L, 113L, 48L, 47L, 30L),
                          groupid=c(1L, 1L, 2L, 3L, 4L),
                          status=factor(rep(c("mated", "unmated"), c(2,3)),
                                        levels=c("mated", "ambiguous", "unmated")))



selFun <- function(identifier, start, end, track, GdObject, ...){
    gcount <- table(group(GdObject))
    ## This computes the width of 2 pixels in genomic coordinates
    pxRange <- Gviz:::.pxResolution(min.width=20, coord="x")
    return((end-start)<pxRange && gcount[identifier]==1)
}
detFun <- function(identifier, GdObject.original, ...){
    plotTracks(list(GenomeAxisTrack(scale=0.3, size=0.2, cex=0.7),
                    GdObject.original[group(GdObject.original)==identifier]),
               add=TRUE, showTitle=FALSE)
}

data(geneDetails)
data(geneModels)

## classes --------------------------------------------------------------------

## IdeogramTrack
ideoTrack <- IdeogramTrack(chromosome="chrI", genome="sacCer3", bands=cyto.bands)

## GenomeAxisTrack
axisTrack <- GenomeAxisTrack(gr)

## DataTrack
dataTrack <- DataTrack(gr)

## AnnotationTrack
annoTrack <- AnnotationTrack(gr)

## GeneRegionTrack
geneTrack <- GeneRegionTrack(geneModels, genome="hg19", chromosome="chr7", name="foo")
## BiomartGeneRegionTrack

## DetailsAnnotationTrack
detTrack <- DetailsAnnotationTrack(geneDetails, fun=detFun, selectFun=selFun,
                                   groupDetails=TRUE, details.size=0.5,
                                   detailsConnector.cex=0.5, detailsConnector.lty="dotted",
                                   shape=c("smallArrow", "arrow"), groupAnnotation="group")

## SequenceTrack
seqTrack.dna <- SequenceTrack(dna.sq)
seqTrack.rna <- RNASequenceTrack(rna.sq)
seqTrack.bs <- SequenceTrack(BSgenome.Hsapiens.UCSC.hg19)

## AlignmentsTrack
alnTrack <- AlignmentsTrack(bamfile)

## HighlightTrack
highTrack <- HighlightTrack(dataTrack, ranges=gr, chromosome="chr1")

## OverlayTrack
overTrack <- OverlayTrack(c(dataTrack, dataTrack))

Try the Gviz package in your browser

Any scripts or data that you put into this service are public.

Gviz documentation built on Nov. 8, 2020, 7:15 p.m.