Nothing
if (!MiscMetabar:::is_swarm_installed()) {
message(
"swarm_clustering() and asv2otu(..., method=swarm) can't be
tested when swarm is not installed"
)
} else {
sequences_ex <- c(
"TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTAATAACGAATTCATTGAATCA",
"TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAAGGCCCACTT",
"TACCTATGTTGCCTTGGCGGCTAAACCTACCCGGGATTTGATGGGGCGAATTACCTGGTAGAGGTG",
"TACCTATGTTGCCTTGGCGGCTAAACCTACC",
"CGGGATTTGATGGCGAATTACCTGGTATTTTAGCCCACTTACCCGGTACCATGAGGTG",
"GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACCTGG",
"GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
"GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG",
"GCGGCTAAACCTACCCGGGATTTGATGGCGAATTACAAAG"
)
test_that("swarm_clustering works fine with phyloseq object", {
expect_s4_class(data_fungi_swarm <- swarm_clustering(data_fungi), "phyloseq")
expect_equal(ntaxa(data_fungi_swarm), 1301)
})
test_that("swarm_clustering works fine with dna sequences vector", {
expect_s3_class(sequences_ex_swarm <- swarm_clustering(dna_seq = sequences_ex), "data.frame")
expect_equal(dim(sequences_ex_swarm), c(12, 10))
})
test_that("asv2otu works fine with swarm method", {
expect_s4_class(
d_swarm <-
asv2otu(data_fungi_sp_known, method = "swarm"),
"phyloseq"
)
expect_equal(ntaxa(d_swarm), 600)
expect_true(nsamples(d_swarm) == nsamples(data_fungi_sp_known))
expect_s3_class(
seq_swarm <-
asv2otu(dna_seq = sequences_ex, method = "swarm"),
"data.frame"
)
expect_equal(dim(seq_swarm), c(12, 10))
})
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.