Nothing
#' The Dinucleotide-based Auto Covariance Descriptor
#'
#' The Dinucleotide-based Auto Covariance Descriptor
#'
#' This function calculates the dinucleotide-based auto covariance descriptor
#'
#' @param x the input data, which should be a list or file type.
#'
#' @param index the physicochemical indices, it should be a list and there are 38
#' different physicochemical indices (Table 1), which the users can choose.
#'
#' @param nlag an integer larger than or equal to 0 and less than or equal to L-2 (L means the length
#' of the shortest DNA sequence in the dataset). It represents the distance between two dinucleotides.
#'
#' @param normaliztion with this option, the final feature vector will be normalized based
#' on the total occurrences of all kmers. Therefore, the elements in the feature vectors
#' represent the frequencies of kmers. The default value of this parameter is False.
#'
#' @param allprop all the 38 physicochemical indices will be
#' employed to generate the feature vector. Its default value is False.
#'
#' @param customprops the users can use their own indices to generate the feature vector. It should be a dict,
#' the key is dinucleotide (string), and its corresponding value is a list type.
#'
#' @return A vector
#'
#' @keywords extract DAC
#'
#' @aliases extrDAC
#'
#' @author Min-feng Zhu <\email{wind2zhu@@163.com}>
#'
#' @export extrDAC
#'
#' @seealso See \code{\link{extrDCC}} and \code{\link{extrDACC}}
#'
#' @note if the user defined physicochemical indices have not been normalized, it should be normalized.
#'
#' @references
#' Dong Q, Zhou S, Guan J. A new taxonomy-based protein fold recognition approach based on
#' autocross-covariance transformation. \emph{Bioinformatics}, 2009, 25(20): 2655-2662.
#'
#'
#' @examples
#'
#' x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
#' extrDAC(x)
extrDAC = function (x, index = c('Twist', 'Tilt'), nlag = 2, normaliztion = FALSE,
customprops = NULL, allprop = FALSE) {
if (!dnacheck(x))
stop ('x has character except A, G, C, T' )
Didx = read.csv(system.file('sysdata/38_dinucleotide_physicochemical_indices.csv', package = 'rDNAse'), header = TRUE, sep = ";")
didx = Didx[, -1]
row.names(didx) = Didx[, 1]
if (allprop) index = Didx[,1]
if (!is.null(customprops)) {
didx = rbind(didx, customprops)
index = c(as.character(index), rownames(customprops))
}
n = length(index)
#### normaliztion ####
Ddict = make_kmer_index(k = 2)
if (normaliztion) {
indmean = rowMeans(didx[index, ])
indsd = apply(didx[index, ], 1, sd)
Pr = data.frame(matrix(ncol = 16, nrow = n))
for (i in 1:n) Pr[i, ] = (didx[index[i], ] - indmean[i])/indsd[i]
names(Pr) = Ddict
}
else Pr = didx[index, ]
xSplit = strsplit(x, split = "")[[1]]
xPaste = paste0(xSplit[1:length(xSplit) - 1], xSplit[2:length(xSplit)])
P = vector('list', n)
for (i in 1:n) P[[i]] = xPaste
for (i in 1:n) {
for (j in Ddict) {
try(P[[i]][which(P[[i]] == j)] <- Pr[i, j], silent = TRUE)
}
}
P = lapply(P, as.numeric)
DAC = vector('list', n)
N = length(xPaste)
for (i in 1:n) {
for (j in 1:nlag) {
Pbar = lapply(seq_along(P), function(i) P[[i]][1:(N-j)])
Pbar = sapply(Pbar, sum)/nchar(x)
DAC[[i]][j] = (sum((P[[i]][1:(N - j)] - Pbar[i]) * (P[[i]][(1:(N - j)) + j] - Pbar[i])))/(N-j)
}
}
DAC = unlist(DAC)
names(DAC) = as.vector(t(outer(index, paste('.lag', 1:nlag, sep = ''),
paste, sep = '')))
DAC = round(DAC, 3)
return(DAC)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.