calculategRNAEfficiency: Calculate gRNA Efficiency

In LihuaJulieZhu/CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems

Calculate gRNA Efficiency

Description

Calculate gRNA Efficiency for a given set of sequences and feature weight matrix

Usage

calculategRNAEfficiency(
  extendedSequence,
  baseBeforegRNA,
  featureWeightMatrix,
  gRNA.size = 20,
  enable.multicore = FALSE,
  n.cores.max = 6
)

Arguments

extendedSequence	Sequences containing gRNA plus PAM plus flanking sequences. Each sequence should be long enough for building features specified in the featureWeightMatrix
baseBeforegRNA	Number of bases before gRNA used for calculating gRNA efficiency, default 4
featureWeightMatrix	a data frame with the first column containing significant features and the second column containing the weight of corresponding features. In the following example, DoenchNBT2014 weight matrix is used. Briefly, features include INTERCEPT GC_LOW - penalty for low GC content in the gRNA sequence GC_HIGH - penalty for high GC content in the gRNA sequence G02 - means G at second position of the extendedSequence GT02 - means GT di-nucleotides starting at 2nd position of the extendedSequence To understand how is the feature weight matrix is identified, or how to use alternative feature weight matrix file, please see Doench et al., 2014 for details.
gRNA.size	The size of the gRNA, default 20
enable.multicore	Indicate whether enable parallel processing, default FALSE. For super long sequences with lots of gRNAs, suggest set it to TRUE
n.cores.max	Indicating maximum number of cores to use in multi core mode, i.e., parallel processing, default 6. Please set it to 1 to disable multicore processing for small dataset.

Value

DNAStringSet consists of potential gRNAs that can be input to filtergRNAs function directly

Author(s)

Lihua Julie Zhu

References

Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M, Ebert BL, Xavier RJ, Root DE. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014 Sep 3. doi: 10.1038 nbt.3026 http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design

See Also

offTargetAnalysis

Examples

 	extendedSequence <- c("TGGATTGTATAATCAGCATGGATTTGGAAC",
		"TCAACGAGGATATTCTCAGGCTTCAGGTCC",
		"GTTACCTGAATTTGACCTGCTCGGAGGTAA",
		"CTTGGTGTGGCTTCCTTTAAGACATGGAGC",
		"CATACAGGCATTGAAGAAGAATTTAGGCCT",
		"AGTACTATACATTTGGCTTAGATTTGGCGG",
		"TTTTCCAGATAGCCGATCTTGGTGTGGCTT",
		"AAGAAGGGAACTATTCGCTGGTGATGGAGT"
	)
	featureWeightMatrixFile <- system.file("extdata", "DoenchNBT2014.csv", 
		package = "CRISPRseek")
	featureWeightMatrix <- read.csv(featureWeightMatrixFile, header=TRUE)
	calculategRNAEfficiency(extendedSequence, baseBeforegRNA = 4, 
		featureWeightMatrix, gRNA.size = 20)

LihuaJulieZhu/CRISPRseek documentation built on Feb. 3, 2024, 2:44 p.m.