writeHits: Write the hits of sequence search from a sequence to a file
In LihuaJulieZhu/CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems

writeHits

R Documentation

Write the hits of sequence search from a sequence to a file

Description

write the hits of sequence search from a sequence instead of BSgenome to a file, internal function used by searchHits

Usage

writeHits(
  gRNA,
  seqname,
  matches,
  strand,
  file,
  gRNA.size = 20L,
  PAM = "NGG",
  PAM.pattern = "N[A|G]G$",
  max.mismatch = 4L,
  chrom.len,
  append = FALSE,
  PAM.location = "3prime",
  PAM.size = 3L,
  allowed.mismatch.PAM = 1L,
  seqs,
  baseEditing = FALSE,
  targetBase = "C",
  editingWindow = 4:8
)

Arguments

`gRNA`	DNAString object with gRNA sequence with PAM appended immediately after,e.g., ACGTACGTACGTACTGACGTCGG with 20bp gRNA sequence plus 3bp PAM sequence CGG
`seqname`	sequence name as character
`matches`	XStringViews object storing matched chromosome locations
`strand`	strand of the match, + for plus strand and - for minus strand
`file`	file path where the hits is written to
`gRNA.size`	gRNA size, default 20
`PAM`	PAM as regular expression for appending to the gRNA, default NGG for SpCas9, change to TTTN for cpf1.
`PAM.pattern`	PAM as regular expression for filtering the hits, default N[A\|G]G$ for spCas9. For cpf1, ^TTTN since it is a 5 prime PAM sequence.
`max.mismatch`	maximum mismatch allowed within the gRNA (excluding PAM portion) for filtering the hits, default 4
`chrom.len`	length of the matched chromosome
`append`	TRUE if append to existing file, false if start a new file
`PAM.location`	PAM location relative to gRNA. For example, spCas9 PAM is located on the 3 prime while cpf1 PAM is located on the 5 prime
`PAM.size`	Size of PAM, default 3
`allowed.mismatch.PAM`	Maximum number of mismatches allowed in the offtargets comparing to the PAM sequence. Default to 1 for NGG PAM
`seqs`	DNAString object containing a DNA sequence.
`baseEditing`	Indicate whether to design gRNAs for base editing. Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and editingWidow accordingly.
`targetBase`	Applicable only when baseEditing is set to TRUE. It is used to indicate the target base for base editing systems, default to C for converting C to T in the CBE system. Please change it to A if you intend to use the ABE system.
`editingWindow`	Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window to consider for the offtargets search only, default to 4 to 8 which is for the original CBE system. Please change it accordingly if the system you use have a different editing window, or you would like to include offtargets with the target base in a larger editing window.

Value

results are saved in the file specified by file

Author(s)

Lihua Julie Zhu

References

http://bioconductor.org/packages/2.8/bioc/vignettes/BSgenome/inst/doc/ GenomeSearching.pdf

Examples


 if(interactive())
 {
    gRNAPlusPAM <- DNAString("ACGTACGTACGTACTGACGTCGG")
    x <- DNAString("AAGCGCGATATGACGTACGTACGTACTGACGTCGG")
    chrom.len <- nchar(as.character(x))
    m <- matchPattern(gRNAPlusPAM, x)
    names(m) <- "testing"
    writeHits(gRNA = gRNAPlusPAM, seqname = "chr1", 
        matches = m, strand = "+", file = "exampleWriteHits.txt", 
        chrom.len = chrom.len, append = FALSE, seqs = x)
 }

LihuaJulieZhu/CRISPRseek documentation built on Feb. 3, 2024, 2:44 p.m.