findgRNAs: Find potential gRNAs
In LihuaJulieZhu/CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems
findgRNAs R Documentation
Find potential gRNAs
Description
Find potential gRNAs for an input file containing sequences in fasta format
Usage
findgRNAs(
inputFilePath,
baseEditing = FALSE,
targetBase = "C",
editingWindow = 4:8,
format = "fasta",
PAM = "NGG",
PAM.size = 3,
findPairedgRNAOnly = FALSE,
annotatePaired = TRUE,
paired.orientation = c("PAMout", "PAMin"),
enable.multicore = FALSE,
n.cores.max = 6,
gRNA.pattern = "",
gRNA.size = 20,
overlap.gRNA.positions = c(17, 18),
primeEditing = FALSE,
PBS.length = 13L,
RT.template.length = 8:28,
RT.template.pattern = "D$",
corrected.seq,
targeted.seq.length.change,
bp.after.target.end = 15L,
target.start,
target.end,
primeEditingPaired.output = "pairedgRNAsForPE.xls",
min.gap = 0,
max.gap = 20,
pairOutputFile,
name.prefix = "",
featureWeightMatrixFile = system.file("extdata", "DoenchNBT2014.csv", package =
"CRISPRseek"),
baseBeforegRNA = 4,
baseAfterPAM = 3,
calculategRNAEfficacy = FALSE,
efficacyFile,
PAM.location = "3prime",
rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016", "CRISPRscan", "DeepCpf1"),
chrom_acc
)
Arguments
inputFilePath
Sequence input file path or a DNAStringSet object that
contains sequences to be searched for potential gRNAs
baseEditing
Indicate whether to design gRNAs for base editing.
Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and
editingWidow accordingly.
targetBase
Applicable only when baseEditing is set to TRUE. It is
used to indicate the target base for base editing systems, default to C for
converting C to T in the CBE system. Please change it to A if you intend to
use the ABE system.
editingWindow
Applicable only when baseEditing is set to TRUE. It is
used to indicate the effective editing window, default to 4 to 8 which is
for the original CBE system. Please change it accordingly if the system you
use have a different editing window.
format
Format of the input file, fasta and fastq are supported,
default fasta
PAM
protospacer-adjacent motif (PAM) sequence after the gRNA, default
NGG
PAM.size
PAM length, default 3
findPairedgRNAOnly
Choose whether to only search for paired gRNAs in
such an orientation that the first one is on minus strand called reverse
gRNA and the second one is on plus strand called forward gRNA. TRUE or
FALSE, default FALSE
annotatePaired
Indicate whether to output paired information, default
TRUE
paired.orientation
PAMin orientation means the two adjacent PAMs on
the sense and antisense strands face inwards towards each other like N21GG
and CCN21 whereas PAMout orientation means they face away from each other
like CCN21 and N21GG
enable.multicore
Indicate whether enable parallel processing, default
FALSE. For super long sequences with lots of gRNAs, suggest set it to TRUE
n.cores.max
Indicating maximum number of cores to use in multi core
mode, i.e., parallel processing, default 6. Please set it to 1 to disable
multicore processing for small dataset.
gRNA.pattern
Regular expression or IUPAC Extended Genetic Alphabet to
represent gRNA pattern, default is no restriction. To specify that the gRNA
must start with GG for example, then set it to ^GG. Please see
help(translatePattern) for a list of IUPAC Extended Genetic Alphabet.
gRNA.size
The size of the gRNA, default 20
overlap.gRNA.positions
The required overlap positions of gRNA and
restriction enzyme cut site, default 17 and 18. For Cpf1,you may set it to 19 and 23.
primeEditing
Indicate whether to design gRNAs for prime editing.
Default to FALSE. If true, please set PBS.length, RT.template.length,
RT.template.pattern, targeted.seq.length.change, bp.after.target.end,
target.start, and target.end accordingly
PBS.length
Applicable only when primeEditing is set to TRUE. It is
used to specify the number of bases to ouput for primer binding site.
RT.template.length
Applicable only when primeEditing is set to TRUE.
It is used to specify the number of bases required for RT template, default
to 8 to 18. Please increase the length if the edit is large insertion. Only
gRNAs with calculated RT.template.length falling into the specified range
will be in the output. It is calculated as the following. RT.template.length
= target.start – cut.start + (target.end - target.start) +
targeted.seq.length.change + bp.after.target.end
RT.template.pattern
Applicable only when primeEditing is set to TRUE.
It is used to specify the RT template sequence pattern, default to not
ending with C according to https://doi.org/10.1038/s41586-019-1711-4
corrected.seq
Applicable only when primeEditing is set to TRUE. It is
used to specify the mutated or inserted sequences after successful editing.
targeted.seq.length.change
Applicable only when primeEditing is set
to TRUE. It is used to specify the number of targeted sequence length
change. Please set it to 0 for base changes, positive numbers for insersion,
and negative number for deletion. For example, 10 means that the corrected
sequence will have 10bp insertion, -10 means that the corrected sequence
will have 10bp deletion, and 0 means only bases have been changed and the
sequence length remains the same
bp.after.target.end
Applicable only when primeEditing is set to TRUE.
It is used to specify the number of bases to add after the target change end
site as part of RT template. Please refer to RT.template.length for how this
parameter influences the RT.template.length calculation which is used as a
filtering criteria in pregRNA selection.
target.start
Applicable only when primeEditing is set to TRUE. It is
used to specify the start location in the input sequence to make changes,
which will be used to obtain the RT template sequence. Please also refer to
RT.template.length for how this parameter influences the RT.template.length
calculation which is used as a filtering criteria in pregRNA selection.
target.end
Applicable only when primeEditing is set to TRUE. It is
used to specify the end location in the input sequnence to make changes,
which will be used to obtain the RT template sequence. Please also refer to
RT.template.length for how this parameter influences the RT.template.length
calculation which is used as a filtering criteria in pregRNA selection.
primeEditingPaired.output
Applicable only when primeEditing is set to
TRUE. It is used to specify the file path to save pegRNA and the second gRNA
with PBS, RT.template, gRNA sequences, default pairedgRNAsForPE.xls
min.gap
Minimum distance between two oppositely oriented gRNAs to be
valid paired gRNAs. Default 0
max.gap
Maximum distance between two oppositely oriented gRNAs to be
valid paired gRNAs. Default 20
pairOutputFile
The output file for writing paired gRNA information to
name.prefix
The prefix used when assign name to found gRNAs, default
gRNA, short for guided RNA.
featureWeightMatrixFile
Feature weight matrix file used for
calculating gRNA efficiency. By default DoenchNBT2014 weight matrix is used.
To use alternative weight matrix file, please input a csv file with first
column containing significant features and the second column containing the
corresponding weights for the features. Please see Doench et al., 2014 for
details.
baseBeforegRNA
Number of bases before gRNA used for calculating gRNA
efficiency, default 4 for spCas9 Please note, for PAM located on the 5
prime, need to specify the number of bases before the PAM sequence plus PAM
size.
baseAfterPAM
Number of bases after PAM used for calculating gRNA
efficiency, default 3 for spCas9 Please note, for PAM located on the 5
prime, need to include the length of the gRNA plus the extended sequence on
the 3 prime
calculategRNAEfficacy
Default to FALSE, not to calculate gRNA
efficacy
efficacyFile
File path to write gRNA efficacies
PAM.location
PAM location relative to gRNA. For example, spCas9 PAM
is located on the 3 prime while cpf1 PAM is located on the 5 prime
rule.set
Specify a rule set scoring system for calculating gRNA
efficacy. Please note that if specifying DeepCpf1, please specify other
parameters accordingly for CRISPR-Cpf1 gRNAs.
chrom_acc
Optional binary variable indicating chromatin accessibility
information with 1 indicating accessible and 0 not accessible.
Details
If users already has a fasta file that contains a set of potential gRNAs,
then users can call filergRNAs directly although the easiest way is to call
the one-stop-shopping function OffTargetAnalysis with findgRNAs set to
FALSE.
Value
DNAStringSet consists of potential gRNAs that can be input to
filtergRNAs function directly
Note
If the input sequence file contains multiple >300 bp sequences,
suggest create one input file for each sequence and run the
OffTargetAnalysis separately.
Author(s)
Lihua Julie Zhu
See Also
offTargetAnalysis
Examples
findgRNAs(inputFilePath = system.file("extdata",
"inputseq.fa", package = "CRISPRseek"),
pairOutputFile = "testpairedgRNAs.xls",
findPairedgRNAOnly = TRUE)
##### predict gRNA efficacy using CRISPRscan
featureWeightMatrixFile <- system.file("extdata", "Morenos-Mateo.csv",
package = "CRISPRseek")
findgRNAs(inputFilePath = system.file("extdata",
"inputseq.fa", package = "CRISPRseek"),
pairOutputFile = "testpairedgRNAs.xls",
findPairedgRNAOnly = FALSE,
calculategRNAEfficacy= TRUE,
rule.set = "CRISPRscan",
baseBeforegRNA = 6, baseAfterPAM = 6,
featureWeightMatrixFile = featureWeightMatrixFile,
efficacyFile = "testCRISPRscanEfficacy.xls"
)
findgRNAs(inputFilePath = system.file("extdata",
"testCRISPRscan.fa", package = "CRISPRseek"),
pairOutputFile = "testpairedgRNAs.xls",
findPairedgRNAOnly = FALSE,
calculategRNAEfficacy= TRUE,
rule.set = "CRISPRscan",
baseBeforegRNA = 6, baseAfterPAM = 6,
featureWeightMatrixFile = featureWeightMatrixFile,
efficacyFile = "testCRISPRscanEfficacy.xls"
)
if (interactive()) {
findgRNAs(inputFilePath = system.file("extdata",
"cpf1.fa", package = "CRISPRseek"),
findPairedgRNAOnly=FALSE,
pairOutputFile = "testpairedgRNAs-cpf1.xls",
PAM="TTTN", PAM.location = "5prime", PAM.size = 4,
overlap.gRNA.positions = c(19, 23),
baseBeforegRNA = 8, baseAfterPAM = 26,
calculategRNAEfficacy= TRUE,
rule.set = "DeepCpf1",
efficacyFile = "testcpf1Efficacy.xls")
findgRNAs(inputFilePath = system.file("extdata",
"cpf1.fa", package = "CRISPRseek"),
findPairedgRNAOnly=FALSE,
pairOutputFile = "testpairedgRNAs-cpf1.xls",
PAM="TTTN", PAM.location = "5prime", PAM.size = 4,
overlap.gRNA.positions = c(19,23),
baseBeforegRNA = 8, baseAfterPAM = 26,
calculategRNAEfficacy= TRUE,
rule.set = "DeepCpf1",
efficacyFile = "testcpf1Efficacy.xls", baseEditing = TRUE,
editingWindow=20, targetBase = "X")
findgRNAs(inputFilePath = system.file("extdata",
"cpf1.fa", package = "CRISPRseek"),
findPairedgRNAOnly=FALSE,
pairOutputFile = "testpairedgRNAs-cpf1.xls",
PAM="TTTN", PAM.location = "5prime", PAM.size = 4,
overlap.gRNA.positions = c(19, 23),
baseBeforegRNA = 8, baseAfterPAM = 26,
calculategRNAEfficacy= TRUE,
rule.set = "DeepCpf1",
efficacyFile = "testcpf1Efficacy.xls", baseEditing = TRUE,
editingWindow=20, targetBase = "C")
}
inputSeq <- DNAStringSet(paste(
"CCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGGATCGAAAACTCA",
"TCAGTCGATGCGAGTCATCTAAATTCCGATCAATTTCACACTTTAAACG", sep =""))
gRNAs <- findgRNAs(inputFilePath = inputSeq,
pairOutputFile = "testpairedgRNAs1.xls",
PAM.size = 3L,
gRNA.size = 20L,
overlap.gRNA.positions = c(17L,18L),
PBS.length = 15,
corrected.seq = "T",
RT.template.pattern = "D$",
RT.template.length = 8:30,
targeted.seq.length.change = 0,
bp.after.target.end = 15,
target.start = 46,
target.end = 46,
paired.orientation = "PAMin", min.gap = 20, max.gap = 90,
primeEditing = TRUE, findPairedgRNAOnly = TRUE)
LihuaJulieZhu/CRISPRseek documentation built on Feb. 3, 2024, 2:44 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
| findgRNAs | R Documentation |
Find potential gRNAs
Description
Find potential gRNAs for an input file containing sequences in fasta format
Usage
findgRNAs(
inputFilePath,
baseEditing = FALSE,
targetBase = "C",
editingWindow = 4:8,
format = "fasta",
PAM = "NGG",
PAM.size = 3,
findPairedgRNAOnly = FALSE,
annotatePaired = TRUE,
paired.orientation = c("PAMout", "PAMin"),
enable.multicore = FALSE,
n.cores.max = 6,
gRNA.pattern = "",
gRNA.size = 20,
overlap.gRNA.positions = c(17, 18),
primeEditing = FALSE,
PBS.length = 13L,
RT.template.length = 8:28,
RT.template.pattern = "D$",
corrected.seq,
targeted.seq.length.change,
bp.after.target.end = 15L,
target.start,
target.end,
primeEditingPaired.output = "pairedgRNAsForPE.xls",
min.gap = 0,
max.gap = 20,
pairOutputFile,
name.prefix = "",
featureWeightMatrixFile = system.file("extdata", "DoenchNBT2014.csv", package =
"CRISPRseek"),
baseBeforegRNA = 4,
baseAfterPAM = 3,
calculategRNAEfficacy = FALSE,
efficacyFile,
PAM.location = "3prime",
rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016", "CRISPRscan", "DeepCpf1"),
chrom_acc
)
Arguments
inputFilePath |
Sequence input file path or a DNAStringSet object that contains sequences to be searched for potential gRNAs |
baseEditing |
Indicate whether to design gRNAs for base editing. Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and editingWidow accordingly. |
targetBase |
Applicable only when baseEditing is set to TRUE. It is used to indicate the target base for base editing systems, default to C for converting C to T in the CBE system. Please change it to A if you intend to use the ABE system. |
editingWindow |
Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window, default to 4 to 8 which is for the original CBE system. Please change it accordingly if the system you use have a different editing window. |
format |
Format of the input file, fasta and fastq are supported, default fasta |
PAM |
protospacer-adjacent motif (PAM) sequence after the gRNA, default NGG |
PAM.size |
PAM length, default 3 |
findPairedgRNAOnly |
Choose whether to only search for paired gRNAs in such an orientation that the first one is on minus strand called reverse gRNA and the second one is on plus strand called forward gRNA. TRUE or FALSE, default FALSE |
annotatePaired |
Indicate whether to output paired information, default TRUE |
paired.orientation |
PAMin orientation means the two adjacent PAMs on the sense and antisense strands face inwards towards each other like N21GG and CCN21 whereas PAMout orientation means they face away from each other like CCN21 and N21GG |
enable.multicore |
Indicate whether enable parallel processing, default FALSE. For super long sequences with lots of gRNAs, suggest set it to TRUE |
n.cores.max |
Indicating maximum number of cores to use in multi core mode, i.e., parallel processing, default 6. Please set it to 1 to disable multicore processing for small dataset. |
gRNA.pattern |
Regular expression or IUPAC Extended Genetic Alphabet to represent gRNA pattern, default is no restriction. To specify that the gRNA must start with GG for example, then set it to ^GG. Please see help(translatePattern) for a list of IUPAC Extended Genetic Alphabet. |
gRNA.size |
The size of the gRNA, default 20 |
overlap.gRNA.positions |
The required overlap positions of gRNA and restriction enzyme cut site, default 17 and 18. For Cpf1,you may set it to 19 and 23. |
primeEditing |
Indicate whether to design gRNAs for prime editing. Default to FALSE. If true, please set PBS.length, RT.template.length, RT.template.pattern, targeted.seq.length.change, bp.after.target.end, target.start, and target.end accordingly |
PBS.length |
Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases to ouput for primer binding site. |
RT.template.length |
Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases required for RT template, default to 8 to 18. Please increase the length if the edit is large insertion. Only gRNAs with calculated RT.template.length falling into the specified range will be in the output. It is calculated as the following. RT.template.length = target.start – cut.start + (target.end - target.start) + targeted.seq.length.change + bp.after.target.end |
RT.template.pattern |
Applicable only when primeEditing is set to TRUE. It is used to specify the RT template sequence pattern, default to not ending with C according to https://doi.org/10.1038/s41586-019-1711-4 |
corrected.seq |
Applicable only when primeEditing is set to TRUE. It is used to specify the mutated or inserted sequences after successful editing. |
targeted.seq.length.change |
Applicable only when primeEditing is set to TRUE. It is used to specify the number of targeted sequence length change. Please set it to 0 for base changes, positive numbers for insersion, and negative number for deletion. For example, 10 means that the corrected sequence will have 10bp insertion, -10 means that the corrected sequence will have 10bp deletion, and 0 means only bases have been changed and the sequence length remains the same |
bp.after.target.end |
Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases to add after the target change end site as part of RT template. Please refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection. |
target.start |
Applicable only when primeEditing is set to TRUE. It is used to specify the start location in the input sequence to make changes, which will be used to obtain the RT template sequence. Please also refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection. |
target.end |
Applicable only when primeEditing is set to TRUE. It is used to specify the end location in the input sequnence to make changes, which will be used to obtain the RT template sequence. Please also refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection. |
primeEditingPaired.output |
Applicable only when primeEditing is set to TRUE. It is used to specify the file path to save pegRNA and the second gRNA with PBS, RT.template, gRNA sequences, default pairedgRNAsForPE.xls |
min.gap |
Minimum distance between two oppositely oriented gRNAs to be valid paired gRNAs. Default 0 |
max.gap |
Maximum distance between two oppositely oriented gRNAs to be valid paired gRNAs. Default 20 |
pairOutputFile |
The output file for writing paired gRNA information to |
name.prefix |
The prefix used when assign name to found gRNAs, default gRNA, short for guided RNA. |
featureWeightMatrixFile |
Feature weight matrix file used for calculating gRNA efficiency. By default DoenchNBT2014 weight matrix is used. To use alternative weight matrix file, please input a csv file with first column containing significant features and the second column containing the corresponding weights for the features. Please see Doench et al., 2014 for details. |
baseBeforegRNA |
Number of bases before gRNA used for calculating gRNA efficiency, default 4 for spCas9 Please note, for PAM located on the 5 prime, need to specify the number of bases before the PAM sequence plus PAM size. |
baseAfterPAM |
Number of bases after PAM used for calculating gRNA efficiency, default 3 for spCas9 Please note, for PAM located on the 5 prime, need to include the length of the gRNA plus the extended sequence on the 3 prime |
calculategRNAEfficacy |
Default to FALSE, not to calculate gRNA efficacy |
efficacyFile |
File path to write gRNA efficacies |
PAM.location |
PAM location relative to gRNA. For example, spCas9 PAM is located on the 3 prime while cpf1 PAM is located on the 5 prime |
rule.set |
Specify a rule set scoring system for calculating gRNA efficacy. Please note that if specifying DeepCpf1, please specify other parameters accordingly for CRISPR-Cpf1 gRNAs. |
chrom_acc |
Optional binary variable indicating chromatin accessibility information with 1 indicating accessible and 0 not accessible. |
Details
If users already has a fasta file that contains a set of potential gRNAs, then users can call filergRNAs directly although the easiest way is to call the one-stop-shopping function OffTargetAnalysis with findgRNAs set to FALSE.
Value
DNAStringSet consists of potential gRNAs that can be input to filtergRNAs function directly
Note
If the input sequence file contains multiple >300 bp sequences, suggest create one input file for each sequence and run the OffTargetAnalysis separately.
Author(s)
Lihua Julie Zhu
See Also
offTargetAnalysis
Examples
findgRNAs(inputFilePath = system.file("extdata",
"inputseq.fa", package = "CRISPRseek"),
pairOutputFile = "testpairedgRNAs.xls",
findPairedgRNAOnly = TRUE)
##### predict gRNA efficacy using CRISPRscan
featureWeightMatrixFile <- system.file("extdata", "Morenos-Mateo.csv",
package = "CRISPRseek")
findgRNAs(inputFilePath = system.file("extdata",
"inputseq.fa", package = "CRISPRseek"),
pairOutputFile = "testpairedgRNAs.xls",
findPairedgRNAOnly = FALSE,
calculategRNAEfficacy= TRUE,
rule.set = "CRISPRscan",
baseBeforegRNA = 6, baseAfterPAM = 6,
featureWeightMatrixFile = featureWeightMatrixFile,
efficacyFile = "testCRISPRscanEfficacy.xls"
)
findgRNAs(inputFilePath = system.file("extdata",
"testCRISPRscan.fa", package = "CRISPRseek"),
pairOutputFile = "testpairedgRNAs.xls",
findPairedgRNAOnly = FALSE,
calculategRNAEfficacy= TRUE,
rule.set = "CRISPRscan",
baseBeforegRNA = 6, baseAfterPAM = 6,
featureWeightMatrixFile = featureWeightMatrixFile,
efficacyFile = "testCRISPRscanEfficacy.xls"
)
if (interactive()) {
findgRNAs(inputFilePath = system.file("extdata",
"cpf1.fa", package = "CRISPRseek"),
findPairedgRNAOnly=FALSE,
pairOutputFile = "testpairedgRNAs-cpf1.xls",
PAM="TTTN", PAM.location = "5prime", PAM.size = 4,
overlap.gRNA.positions = c(19, 23),
baseBeforegRNA = 8, baseAfterPAM = 26,
calculategRNAEfficacy= TRUE,
rule.set = "DeepCpf1",
efficacyFile = "testcpf1Efficacy.xls")
findgRNAs(inputFilePath = system.file("extdata",
"cpf1.fa", package = "CRISPRseek"),
findPairedgRNAOnly=FALSE,
pairOutputFile = "testpairedgRNAs-cpf1.xls",
PAM="TTTN", PAM.location = "5prime", PAM.size = 4,
overlap.gRNA.positions = c(19,23),
baseBeforegRNA = 8, baseAfterPAM = 26,
calculategRNAEfficacy= TRUE,
rule.set = "DeepCpf1",
efficacyFile = "testcpf1Efficacy.xls", baseEditing = TRUE,
editingWindow=20, targetBase = "X")
findgRNAs(inputFilePath = system.file("extdata",
"cpf1.fa", package = "CRISPRseek"),
findPairedgRNAOnly=FALSE,
pairOutputFile = "testpairedgRNAs-cpf1.xls",
PAM="TTTN", PAM.location = "5prime", PAM.size = 4,
overlap.gRNA.positions = c(19, 23),
baseBeforegRNA = 8, baseAfterPAM = 26,
calculategRNAEfficacy= TRUE,
rule.set = "DeepCpf1",
efficacyFile = "testcpf1Efficacy.xls", baseEditing = TRUE,
editingWindow=20, targetBase = "C")
}
inputSeq <- DNAStringSet(paste(
"CCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGGATCGAAAACTCA",
"TCAGTCGATGCGAGTCATCTAAATTCCGATCAATTTCACACTTTAAACG", sep =""))
gRNAs <- findgRNAs(inputFilePath = inputSeq,
pairOutputFile = "testpairedgRNAs1.xls",
PAM.size = 3L,
gRNA.size = 20L,
overlap.gRNA.positions = c(17L,18L),
PBS.length = 15,
corrected.seq = "T",
RT.template.pattern = "D$",
RT.template.length = 8:30,
targeted.seq.length.change = 0,
bp.after.target.end = 15,
target.start = 46,
target.end = 46,
paired.orientation = "PAMin", min.gap = 20, max.gap = 90,
primeEditing = TRUE, findPairedgRNAOnly = TRUE)
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.