searchHits2: Search for off targets

In LihuaJulieZhu/CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems

Search for off targets

Description

Search for off targets for given gRNAs, BSgenome and maximum mismatches

Usage

searchHits2(
  gRNAs,
  BSgenomeName,
  chromToSearch = "all",
  chromToExclude = "",
  max.mismatch = 3,
  PAM.size = 3,
  gRNA.size = 20,
  PAM = "NGG",
  PAM.pattern = "N[A|G]G$",
  allowed.mismatch.PAM = 1,
  PAM.location = "3prime",
  baseEditing = FALSE,
  targetBase = "C",
  editingWindow = 4:8
)

Arguments

gRNAs	DNAStringSet object containing a set of gRNAs. Please note the sequences must contain PAM appended after gRNAs, e.g., ATCGAAATTCGAGCCAATCCCGG where ATCGAAATTCGAGCCAATCC is the gRNA and CGG is the PAM
BSgenomeName	BSgenome object. Please refer to available.genomes in BSgenome package. For example, BSgenome.Hsapiens.UCSC.hg19 - for hg19, BSgenome.Mmusculus.UCSC.mm10 - for mm10 BSgenome.Celegans.UCSC.ce6 - for ce6 BSgenome.Rnorvegicus.UCSC.rn5 - for rn5 BSgenome.Drerio.UCSC.danRer7 - for Zv9 BSgenome.Dmelanogaster.UCSC.dm3 - for dm3
chromToSearch	Specify the chromosome to search, default to all, meaning search all chromosomes. For example, chrX indicates searching for matching in chromosome X only
chromToExclude	Specify the chromosome not to search, default to none, meaning to search chromosomes specified by chromToSearch. For example, to exclude haplotype blocks from offtarget search in hg19, set chromToExclude to c(""chr17_ctg5_hap1","chr4_ctg9_hap1", "chr6_apd_hap1", "chr6_cox_hap2", "chr6_dbb_hap3", "chr6_mann_hap4", "chr6_mcf_hap5","chr6_qbl_hap6", "chr6_ssto_hap7")
max.mismatch	Maximum mismatch allowed in off target search, default 3. Warning: will be considerably slower if it is set to greater than 3
PAM.size	Size of PAM, default 3
gRNA.size	Size of gRNA, default 20
PAM	Regular expression of protospacer-adjacent motif (PAM), default NGG for spCas9. For cpf1, ^TTTN
PAM.pattern	Regular expression of PAM, default N[A|G]G$ for spCas9. For cpf1, ^TTTN since it is a 5 prime PAM sequence
allowed.mismatch.PAM	Number of degenerative bases in the PAM sequence, default to 1 for N[A|G]G PAM
PAM.location	PAM location relative to gRNA. For example, spCas9 PAM is located on the 3 prime while cpf1 PAM is located on the 5 prime
baseEditing	Indicate whether to design gRNAs for base editing. Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and editingWidow accordingly.
targetBase	Applicable only when baseEditing is set to TRUE. It is used to indicate the target base for base editing systems, default to C for converting C to T in the CBE system. Please change it to A if you intend to use the ABE system.
editingWindow	Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window to consider for the offtargets search only, default to 4 to 8 which is for the original CBE system. Please change it accordingly if the system you use have a different editing window, or you would like to include offtargets with the target base in a larger editing window.

Value

a data frame contains

• IsMismatch.posX - indicator variable indicating whether this position X is mismatch or not, (1 means yes and 0 means not). X takes on values from 1 to gRNA.size, representing all positions in the guide RNA (gRNA).

• strand - strand of the match, + for plus and - for minus strand

• chrom - chromosome of the off target

• chromStart - start position of the off target

• chromEnd - end position of the off target

• name - gRNA name

• gRNAPlusPAM - gRNA sequence with PAM sequence concatenated

• OffTargetSequence - the genomic sequence of the off target

• n.mismatch - number of mismatches between the off target and the gRNA

• forViewInUCSC - string for viewing in UCSC genome browser, e.g., chr14:31665685-31665707

• score - set to 100, and will be updated in getOfftargetScore

Author(s)

Lihua Julie Zhu

See Also

offTargetAnalysis

Examples

    all.gRNAs <- findgRNAs(inputFilePath = 
        system.file("extdata", "inputseq.fa", package = "CRISPRseek"),
        pairOutputFile = "pairedgRNAs.xls",
	findPairedgRNAOnly = TRUE)

    library("BSgenome.Hsapiens.UCSC.hg19")
    ### for speed reason, use max.mismatch = 0 for finding all targets with 
    ### all variants of PAM
    hits <- searchHits2(all.gRNAs[1], BSgenomeName = Hsapiens,
        max.mismatch = 0, chromToSearch = "chrX")
    colnames(hits)

    ### test PAM located at 5 prime
    all.gRNAs <- findgRNAs(inputFilePath = 
             system.file("extdata", "inputseq.fa", package = "CRISPRseek"),
             pairOutputFile = "pairedgRNAs.xls",
             findPairedgRNAOnly = FALSE,
             PAM = "TGT", PAM.location = "5prime")
     
    library("BSgenome.Hsapiens.UCSC.hg19")
         ### for speed reason, use max.mismatch = 0 for finding all targets with 
         ### all variants of PAM
    hits <- searchHits2(all.gRNAs[1], BSgenomeName = Hsapiens, PAM.size = 3,
        max.mismatch = 0, chromToSearch = "chrX", PAM.location = "5prime",
        PAM = "NGG", 
        PAM.pattern = "^T[A|G]N", allowed.mismatch.PAM = 2)
    colnames(hits)

LihuaJulieZhu/CRISPRseek documentation built on Feb. 3, 2024, 2:44 p.m.