predictRelativeFreqIndels: Predict insertions and deletions induced by CRISPR/Cas9...

In LihuaJulieZhu/CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems

Predict insertions and deletions induced by CRISPR/Cas9 editing

Description

Predict insertions and deletions, and associated reletive frequecies induced by CRISPR/Cas9 editing

Usage

predictRelativeFreqIndels(extendedSequence, method = "Lindel")

Arguments

extendedSequence	A vector of DNA sequences of length 60bp. It consists 30bp before the cut site and 30bp after the cut site.
method	the prediction method. default to Lindel. Currently only Lindel method are implemented.

Details

Predict relative indel frequency around target sites of CRISPR/Cas9 system. Currently only Lindel method using logistic regression is implemented in CRISPRseek.

Lindel is compatible with both Python2.7 and Python3.5 or higher.

By default, reticulate uses the version of Python found on your PATH (i.e. Sys.which("python")).

Use the function use_python in reticulate library to set the python path to a specific version. For example, use_python('/opt/anaconda3/lib/python3.7')

This function implements the Lindel method

Value

A list with the same length as the input extendedSequence.

Each list item either contains a warning message, or a predicted fraction of frameshift in the mutational outcomes plus a data frame with three columns.

The three columns are the alignment of predicted indel sequence to the original unedited sequence, predicted indel frequency, and the location of the predicted indels. The warning message for the Lindel method is as follows.

Warning: No PAM sequence is identified. Please check your sequence and try again.

A list with the same length as the input extendedSequence.

Each list item either contains a warning message, or a predicted fraction of frameshift in the mutational outcomes plus a data frame with three columns.

The three columns are the alignment of predicted indel sequence to the original unedited sequence, predicted indel frequency, and the location of the predicted indels. The warning message for the Lindel method is as follows.

Warning: No PAM sequence is identified. Please check your sequence and try again.

Author(s)

Hui Mao and Lihua Julie Zhu Predict insertions and deletions induced by CRISPR/Cas9 editing

Predict insertions and deletions, and associated reletive frequecies induced by CRISPR/Cas9 editing

Predict relative indel frequency around target sites of CRISPR/Cas9 system. Currently only Lindel method using logistic regression is implemented in CRISPRseek.

Lindel is compatible with both Python2.7 and Python3.5 or higher.

By default, reticulate uses the version of Python found on your PATH (i.e. Sys.which("python")).

Use the function use_python in reticulate library to set the python path to a specific version. For example, use_python('/opt/anaconda3/lib/python3.7')

This function implements the Lindel method

Hui Mao and Lihua Julie Zhu

References

Wei Chen, Aaron McKenna, Jacob Schreiber et al., Massively parallel profiling and predictive modeling of the outcomes of CRISPR/Cas9-mediated double-strand break repair, Nucleic Acids Research, Volume 47, Issue 15, 05 September 2019, Pages 7989–8003, https://doi.org/10.1093/nar/gkz487

Wei Chen, Aaron McKenna, Jacob Schreiber et al., Massively parallel profiling and predictive modeling of the outcomes of CRISPR/Cas9-mediated double-strand break repair, Nucleic Acids Research, Volume 47, Issue 15, 05 September 2019, Pages 7989–8003, https://doi.org/10.1093/nar/gkz487

Examples

extendedSequence <- c("AAA", "TAACGTTATCAACGCCTATATTAAAGCGACCGTCGGTTGAACTGCGTGGATCAATGCGTC")
if (interactive())
    indelFreq <- predictRelativeFreqIndels(extendedSequence, method = "Lindel") 



extendedSequence <- c("AAA", "TAACGTTATCAACGCCTATATTAAAGCGACCGTCGGTTGAACTGCGTGGATCAATGCGTC")
if (interactive())
    indelFreq <- predictRelativeFreqIndels(extendedSequence, method = "Lindel") 

LihuaJulieZhu/CRISPRseek documentation built on Feb. 3, 2024, 2:44 p.m.